Transcript: Human XM_011525259.2

PREDICTED: Homo sapiens acyl-CoA binding domain containing 4 (ACBD4), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACBD4 (79777)
Length:
1687
CDS:
715..1491

Additional Resources:

NCBI RefSeq record:
XM_011525259.2
NBCI Gene record:
ACBD4 (79777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144734 GCGATTCTACAGTTACTACAA pLKO.1 834 CDS 100% 4.950 6.930 N ACBD4 n/a
2 TRCN0000122281 CCTGCCCAAGAACGGTTCTTA pLKO.1 789 CDS 100% 5.625 3.938 N ACBD4 n/a
3 TRCN0000145258 GCCTACATCACTGAAATGAAA pLKO.1 973 CDS 100% 5.625 3.938 N ACBD4 n/a
4 TRCN0000140531 GAAGAGATGCTGCGATTCTAC pLKO.1 823 CDS 100% 4.950 3.465 N ACBD4 n/a
5 TRCN0000139381 GTTGGAAAGAGCAGGTTGTGA pLKO.1 1130 CDS 100% 3.000 2.100 N ACBD4 n/a
6 TRCN0000139507 CATGTCTGCCTACATCACTGA pLKO.1 966 CDS 100% 2.640 1.848 N ACBD4 n/a
7 TRCN0000122717 CCTATGAAGAGATGCTGCGAT pLKO.1 818 CDS 100% 2.640 1.848 N ACBD4 n/a
8 TRCN0000144424 CATCACTGAAATGAAACTGGT pLKO.1 978 CDS 100% 2.640 1.584 N ACBD4 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1654 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1655 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15990 pDONR223 0% 73.7% 53.1% None (many diffs) n/a
2 ccsbBroad304_15990 pLX_304 0% 73.7% 53.1% V5 (many diffs) n/a
3 TRCN0000475165 TATAAAGATTGACATCCGACGTGG pLX_317 5.9% 73.7% 53.1% V5 (many diffs) n/a
4 ccsbBroadEn_08957 pDONR223 100% 72.2% 64% None (many diffs) n/a
5 ccsbBroad304_08957 pLX_304 0% 72.2% 64% V5 (many diffs) n/a
6 TRCN0000479044 TGGCGGGCTAAATACACTTAATAC pLX_317 40.1% 72.2% 64% V5 (many diffs) n/a
Download CSV