Transcript: Human XM_011527854.2

PREDICTED: Homo sapiens bromodomain containing 4 (BRD4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRD4 (23476)
Length:
5701
CDS:
72..4160

Additional Resources:

NCBI RefSeq record:
XM_011527854.2
NBCI Gene record:
BRD4 (23476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196576 GCCAAATGTCTACACAGTATA pLKO.1 4475 3UTR 100% 13.200 18.480 N BRD4 n/a
2 TRCN0000349580 GCCAAATGTCTACACAGTATA pLKO_005 4475 3UTR 100% 13.200 18.480 N BRD4 n/a
3 TRCN0000199427 CAGTGACAGTTCGACTGATGA pLKO.1 1556 CDS 100% 4.950 6.930 N BRD4 n/a
4 TRCN0000318773 CAGTGACAGTTCGACTGATGA pLKO_005 1556 CDS 100% 4.950 6.930 N BRD4 n/a
5 TRCN0000199459 GCCTATGTCCTATGAGGAGAA pLKO.1 1895 CDS 100% 4.050 5.670 N BRD4 n/a
6 TRCN0000349783 TGAACCTCCCTGATTACTATA pLKO_005 346 CDS 100% 13.200 10.560 N Brd4 n/a
7 TRCN0000382028 TGAACCTCCCTGATTACTATA pLKO_005 346 CDS 100% 13.200 10.560 N BRD4 n/a
8 TRCN0000021426 CGTCCGATTGATGTTCTCCAA pLKO.1 1334 CDS 100% 2.640 2.112 N BRD4 n/a
9 TRCN0000318836 CGTCCGATTGATGTTCTCCAA pLKO_005 1334 CDS 100% 2.640 2.112 N BRD4 n/a
10 TRCN0000380416 ATGAGCACAATCAAGTCTAAA pLKO_005 1269 CDS 100% 13.200 9.240 N BRD4 n/a
11 TRCN0000195294 CAGAGTGATCTATTGTCAATA pLKO.1 4119 CDS 100% 13.200 9.240 N BRD4 n/a
12 TRCN0000195245 CCTATGGATATGGGAACAATA pLKO.1 381 CDS 100% 13.200 9.240 N BRD4 n/a
13 TRCN0000380426 GAATTTCCAGAGTGATCTATT pLKO_005 4112 CDS 100% 13.200 9.240 N BRD4 n/a
14 TRCN0000199674 GCATCCTCAAGGAGATGTTTG pLKO.1 1147 CDS 100% 10.800 7.560 N BRD4 n/a
15 TRCN0000088479 CCTCCCTGATTACTATAAGAT pLKO.1 350 CDS 100% 5.625 3.938 N Brd4 n/a
16 TRCN0000021428 CCAGAGTGATCTATTGTCAAT pLKO.1 4118 CDS 100% 4.950 3.465 N BRD4 n/a
17 TRCN0000021425 CCCTGATTACTATAAGATCAT pLKO.1 353 CDS 100% 4.950 3.465 N BRD4 n/a
18 TRCN0000021427 CCTGGAGATGACATAGTCTTA pLKO.1 495 CDS 100% 4.950 3.465 N BRD4 n/a
19 TRCN0000318771 CCTGGAGATGACATAGTCTTA pLKO_005 495 CDS 100% 4.950 3.465 N BRD4 n/a
20 TRCN0000199972 CCAACCAAAGTCAGTTCCTTC pLKO.1 4854 3UTR 100% 4.050 2.835 N BRD4 n/a
21 TRCN0000021424 CCGCCAAATGTCTACACAGTA pLKO.1 4473 3UTR 100% 4.950 2.970 N BRD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11738 pDONR223 100% 56.5% 52.2% None (many diffs) n/a
2 ccsbBroad304_11738 pLX_304 0% 56.5% 52.2% V5 (many diffs) n/a
3 TRCN0000477053 TCTAGTTTCTTACTTTTTGCCGAC pLX_317 9.5% 56.5% 52.2% V5 (many diffs) n/a
4 TRCN0000487806 ATCGTTGCGGCTGACGACGATGAT pLX_317 12.2% 56.5% 52.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15013 pDONR223 71.9% 52.7% 19.2% None (many diffs) n/a
6 ccsbBroad304_15013 pLX_304 26.9% 52.7% 19.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000491254 CTCAGTAGTCTGCAGGTTTCGGTT pLX_317 11.4% 52.7% 19.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV