Transcript: Human XM_011529828.2

PREDICTED: Homo sapiens ret finger protein like 2 (RFPL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFPL2 (10739)
Length:
2808
CDS:
1221..2471

Additional Resources:

NCBI RefSeq record:
XM_011529828.2
NBCI Gene record:
RFPL2 (10739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423182 AGGAACGCTCTACTTCGTAAA pLKO_005 2530 3UTR 100% 10.800 8.640 N RFPL2 n/a
2 TRCN0000429941 TCAAACTCATTGAGTCCTATG pLKO_005 2654 3UTR 100% 6.000 4.200 N RFPL2 n/a
3 TRCN0000422699 TTAGATTATAGAGTCCTAAGT pLKO_005 2616 3UTR 100% 4.950 3.465 N RFPL2 n/a
4 TRCN0000428815 CTCTTCCATGGTCTCTCGGAA pLKO_005 1757 CDS 100% 2.640 1.848 N RFPL2 n/a
5 TRCN0000033759 CGTCTGCCTCAAGTGCATTAA pLKO.1 1691 CDS 100% 13.200 7.920 N RFPL2 n/a
6 TRCN0000033758 GCGGAAGTTCCAAGTGGATAT pLKO.1 1877 CDS 100% 10.800 5.400 Y RFPL3 n/a
7 TRCN0000033761 CTCTTCGTAGACCGCAAGTTA pLKO.1 2223 CDS 100% 5.625 2.813 Y RFPL2 n/a
8 TRCN0000033689 GCCAACAACTTCCTCCTCATT pLKO.1 1917 CDS 100% 4.950 2.475 Y RFPL1 n/a
9 TRCN0000033763 GCTGAAGAAGATTCTGCAGAT pLKO.1 1844 CDS 100% 4.050 2.025 Y RFPL2 n/a
10 TRCN0000033762 GTCTATACATTCAGGAGCGTA pLKO.1 2316 CDS 100% 2.640 1.320 Y RFPL2 n/a
11 TRCN0000033756 CCCAAGCTGAAGAAGATTCTA pLKO.1 1839 CDS 100% 5.625 2.813 Y RFPL3 n/a
12 TRCN0000291861 CCCAAGCTGAAGAAGATTCTA pLKO_005 1839 CDS 100% 5.625 2.813 Y RFPL3 n/a
13 TRCN0000033693 CGAGAGATTTGACGTGTCCAT pLKO.1 1997 CDS 100% 2.640 1.320 Y RFPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02517 pDONR223 100% 69.2% 69.2% None 1_384del n/a
2 ccsbBroad304_02517 pLX_304 0% 69.2% 69.2% V5 1_384del n/a
3 TRCN0000481078 GTATTACCAGGTGCGATTAGCTGT pLX_317 51.6% 69.2% 69.2% V5 1_384del n/a
4 ccsbBroadEn_07672 pDONR223 100% 67.3% 65.1% None (many diffs) n/a
5 ccsbBroad304_07672 pLX_304 0% 67.3% 65.1% V5 (many diffs) n/a
Download CSV