Transcript: Human XM_011540058.3

PREDICTED: Homo sapiens phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHPP (64077)
Length:
4081
CDS:
41..700

Additional Resources:

NCBI RefSeq record:
XM_011540058.3
NBCI Gene record:
LHPP (64077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049995 CCGCTCAGAATTTGATCAGAT pLKO.1 358 CDS 100% 4.950 6.930 N LHPP n/a
2 TRCN0000333134 CCGCTCAGAATTTGATCAGAT pLKO_005 358 CDS 100% 4.950 6.930 N LHPP n/a
3 TRCN0000049997 CTACATGAAGGCGCTTGAGTA pLKO.1 553 CDS 100% 4.950 6.930 N LHPP n/a
4 TRCN0000049996 GATCGACACATCCAACCCAAA pLKO.1 376 CDS 100% 4.050 5.670 N LHPP n/a
5 TRCN0000333068 GATCGACACATCCAACCCAAA pLKO_005 376 CDS 100% 4.050 5.670 N LHPP n/a
6 TRCN0000049993 CAACCCAAACTGTGTGGTAAT pLKO.1 388 CDS 100% 10.800 8.640 N LHPP n/a
7 TRCN0000333069 CAACCCAAACTGTGTGGTAAT pLKO_005 388 CDS 100% 10.800 8.640 N LHPP n/a
8 TRCN0000382111 AGTATGCCTGTGGCATCAAAG pLKO_005 570 CDS 100% 10.800 7.560 N LHPP n/a
9 TRCN0000380889 GGACGTTGGTCCCTACATGAA pLKO_005 541 CDS 100% 4.950 3.465 N LHPP n/a
10 TRCN0000049994 CTGTGCTCATATCACTGGGAA pLKO.1 483 CDS 100% 2.640 1.848 N LHPP n/a
11 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 3801 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08825 pDONR223 100% 95.4% 94.5% None (many diffs) n/a
2 ccsbBroad304_08825 pLX_304 0% 95.4% 94.5% V5 (many diffs) n/a
3 TRCN0000474036 ACCACTCGTTCGCAAAAAGCTTTT pLX_317 71.3% 95.4% 94.5% V5 (many diffs) n/a
4 ccsbBroadEn_08826 pDONR223 100% 79% 76.8% None (many diffs) n/a
5 ccsbBroad304_08826 pLX_304 0% 79% 76.8% V5 (many diffs) n/a
Download CSV