Transcript: Human XM_011541234.2

PREDICTED: Homo sapiens guanylate binding protein 3 (GBP3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GBP3 (2635)
Length:
2801
CDS:
210..1754

Additional Resources:

NCBI RefSeq record:
XM_011541234.2
NBCI Gene record:
GBP3 (2635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370506 TGGTGGAGGAAATGCAAATAA pLKO_005 1474 CDS 100% 15.000 10.500 N GBP3 n/a
2 TRCN0000365397 AGCCTAGTGCTGACCTATATC pLKO_005 843 CDS 100% 13.200 9.240 N GBP3 n/a
3 TRCN0000365327 GGAACAGGCCCGAGTACTAAA pLKO_005 1625 CDS 100% 13.200 9.240 N GBP3 n/a
4 TRCN0000370444 GGAGGCCACTGAAGTCTATAT pLKO_005 1046 CDS 100% 13.200 9.240 N GBP3 n/a
5 TRCN0000365398 GCATAAGCTAAAGATCTAAAC pLKO_005 1736 CDS 100% 10.800 7.560 N GBP3 n/a
6 TRCN0000148690 CCCAAGGCATAACTGAAACAA pLKO.1 1781 3UTR 100% 5.625 3.938 N GBP3 n/a
7 TRCN0000146617 CTCACTAGTAAACTTCAGGAA pLKO.1 1608 CDS 100% 0.000 0.000 N GBP3 n/a
8 TRCN0000370442 CTCTGGGCTCCACAGTGAAAT pLKO_005 406 CDS 100% 13.200 7.920 N GBP3 n/a
9 TRCN0000147062 CCAAGGCATAACTGAAACAAT pLKO.1 1782 3UTR 100% 5.625 3.375 N GBP3 n/a
10 TRCN0000148170 GCAGACATACTTGAAATCCAA pLKO.1 1343 CDS 100% 3.000 1.500 Y GBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06263 pDONR223 100% 77.5% 73.1% None (many diffs) n/a
2 ccsbBroad304_06263 pLX_304 0% 77.5% 73.1% V5 (many diffs) n/a
3 TRCN0000466638 CCGTTGTCGCAGGTAGGATGGTGT pLX_317 25.6% 77.5% 73.1% V5 (many diffs) n/a
4 ccsbBroadEn_06264 pDONR223 100% 71.6% 65.2% None (many diffs) n/a
5 ccsbBroad304_06264 pLX_304 0% 71.6% 65.2% V5 (many diffs) n/a
6 TRCN0000472242 ACACATGCGGCTCGGTCTTCGCTG pLX_317 27.3% 71.6% 65.2% V5 (many diffs) n/a
7 ccsbBroadEn_10841 pDONR223 100% 50.2% 43.8% None (many diffs) n/a
8 ccsbBroad304_10841 pLX_304 0% 50.2% 43.8% V5 (many diffs) n/a
9 TRCN0000465445 GTGGGTAACAGGAGCAGAAACGGG pLX_317 24.2% 50.2% 43.8% V5 (many diffs) n/a
Download CSV