Transcript: Human XM_011541772.2

PREDICTED: Homo sapiens protein kinase N2 (PKN2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKN2 (5586)
Length:
6204
CDS:
1754..3730

Additional Resources:

NCBI RefSeq record:
XM_011541772.2
NBCI Gene record:
PKN2 (5586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194752 CAATCATGTAACAGGCTTATA pLKO.1 4351 3UTR 100% 13.200 18.480 N PKN2 n/a
2 TRCN0000353006 CAATCATGTAACAGGCTTATA pLKO_005 4351 3UTR 100% 13.200 18.480 N PKN2 n/a
3 TRCN0000379782 GGCCTAGAATATAGTGGTATT pLKO_005 2669 CDS 100% 10.800 15.120 N PKN2 n/a
4 TRCN0000377251 TTACCTCAGAAGCACCTATTC pLKO_005 3624 CDS 100% 10.800 15.120 N PKN2 n/a
5 TRCN0000195219 CTTAGCATGTTAGGGTCATTA pLKO.1 5186 3UTR 100% 13.200 10.560 N PKN2 n/a
6 TRCN0000422087 ATTGTACTTCAGCGTAAATAT pLKO_005 3910 3UTR 100% 15.000 10.500 N PKN2 n/a
7 TRCN0000196735 GCAGGGTCTATTTACACAATT pLKO.1 5784 3UTR 100% 13.200 9.240 N PKN2 n/a
8 TRCN0000219650 TACTTTGGAAGTTCGTCTTAT pLKO.1 1762 CDS 100% 13.200 9.240 N PKN2 n/a
9 TRCN0000332970 TACTTTGGAAGTTCGTCTTAT pLKO_005 1762 CDS 100% 13.200 9.240 N PKN2 n/a
10 TRCN0000012716 CCAAGGTTCTTATCTACAGAA pLKO.1 3404 CDS 100% 4.950 3.465 N Pkn2 n/a
11 TRCN0000006252 CCACCATTTATACCTACCATA pLKO.1 3566 CDS 100% 4.950 3.465 N PKN2 n/a
12 TRCN0000006253 GCACATTCATACTGATGTCTT pLKO.1 3016 CDS 100% 4.950 3.465 N PKN2 n/a
13 TRCN0000006250 GCCACCAATAGCTTCTGAGTT pLKO.1 3807 3UTR 100% 4.950 3.465 N PKN2 n/a
14 TRCN0000084683 CCCAAGATCCTTTGGGAGAAA pLKO.1 5456 3UTR 100% 0.495 0.347 N Zfp646 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489928 AAGTCCCACCATTGCGCAATTGCA pLX_317 14.6% 66.8% 66.5% V5 (not translated due to prior stop codon) 0_1ins946;3G>C;7_8ins32 n/a
2 ccsbBroadEn_15539 pDONR223 0% 61.8% 61.5% None (many diffs) n/a
3 ccsbBroad304_15539 pLX_304 0% 61.8% 61.5% V5 (many diffs) n/a
4 ccsbBroadEn_15538 pDONR223 0% 9.1% 9.1% None 1_1794del n/a
5 ccsbBroad304_15538 pLX_304 0% 9.1% 9.1% V5 1_1794del n/a
6 TRCN0000468463 GCACGTAACCATTAAAGTGCCTCT pLX_317 100% 9.1% 9.1% V5 1_1794del n/a
Download CSV