Transcript: Human XM_011542707.2

PREDICTED: Homo sapiens pleckstrin homology like domain family B member 1 (PHLDB1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHLDB1 (23187)
Length:
6598
CDS:
762..5393

Additional Resources:

NCBI RefSeq record:
XM_011542707.2
NBCI Gene record:
PHLDB1 (23187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427103 AGACCACATCGACCCTCAAAG pLKO_005 3613 CDS 100% 10.800 15.120 N PHLDB1 n/a
2 TRCN0000418641 AGCGCACCCTTTCCTATTATG pLKO_005 5110 CDS 100% 13.200 10.560 N PHLDB1 n/a
3 TRCN0000435050 AGCTGAAGGGAGTCATCTATT pLKO_005 5149 CDS 100% 13.200 9.240 N PHLDB1 n/a
4 TRCN0000418636 AGAACTTGCAGTAACCCTTTA pLKO_005 5554 3UTR 100% 10.800 7.560 N PHLDB1 n/a
5 TRCN0000418350 CCTCTCATGCACCACTCTATC pLKO_005 4512 CDS 100% 10.800 7.560 N PHLDB1 n/a
6 TRCN0000428621 CCTGAACCTGTGTGCCGAATA pLKO_005 2750 CDS 100% 10.800 7.560 N PHLDB1 n/a
7 TRCN0000156825 GCTGAAGCCAAGTGGATGAAA pLKO.1 1305 CDS 100% 5.625 3.938 N PHLDB1 n/a
8 TRCN0000426499 CAAGGGCCAGAGATCTCAAGT pLKO_005 5864 3UTR 100% 4.950 3.465 N PHLDB1 n/a
9 TRCN0000153543 CGTATCTGGATGGATGTCATT pLKO.1 5334 CDS 100% 4.950 3.465 N PHLDB1 n/a
10 TRCN0000152972 GAGACTGAGACAAAGCTCTTT pLKO.1 3294 CDS 100% 4.950 3.465 N PHLDB1 n/a
11 TRCN0000153924 CCATTGTTCTCCTTTCCCTTA pLKO.1 5824 3UTR 100% 4.050 2.835 N PHLDB1 n/a
12 TRCN0000157566 GCTGAAAGTGCAAACGGACAA pLKO.1 995 CDS 100% 4.050 2.835 N PHLDB1 n/a
13 TRCN0000158369 CTCATGCACCACTCTATCCTA pLKO.1 4515 CDS 100% 3.000 2.100 N PHLDB1 n/a
14 TRCN0000153124 GCAGAATCAGAAAGTCTGGTA pLKO.1 1380 CDS 100% 2.640 1.848 N PHLDB1 n/a
15 TRCN0000428665 AGCTTGGTCCTGTGAGTTTCT pLKO_005 5462 3UTR 100% 4.950 2.970 N PHLDB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488190 CTGAACTGGGGGTAGCATCTTATC pLX_317 8.9% 85.3% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491363 CTGATCGGTTGCCGTGTGGTGCGG pLX_317 1.1% 74.5% 51.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11690 pDONR223 100% 6.5% 6.5% None 1_4293del;4457_4489del n/a
4 ccsbBroad304_11690 pLX_304 0% 6.5% 6.5% V5 1_4293del;4457_4489del n/a
5 TRCN0000473611 TCAATCCTGAGCTGCAGGCAATGA pLX_317 100% 6.5% 6.5% V5 1_4293del;4457_4489del n/a
Download CSV