Transcript: Human XM_017001211.2

PREDICTED: Homo sapiens inositol-trisphosphate 3-kinase B (ITPKB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPKB (3707)
Length:
10055
CDS:
462..2654

Additional Resources:

NCBI RefSeq record:
XM_017001211.2
NBCI Gene record:
ITPKB (3707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195620 CATACCTGCTGTCATCATTAC pLKO.1 2156 CDS 100% 10.800 8.640 N ITPKB n/a
2 TRCN0000431828 ACCAGAAAGTGGGCATGTTTG pLKO_005 892 CDS 100% 10.800 7.560 N ITPKB n/a
3 TRCN0000037713 ACAGCTATGGAAATTGACAAA pLKO.1 1272 CDS 100% 4.950 3.465 N ITPKB n/a
4 TRCN0000422702 AGACGACTGTGAGCGTGCAAA pLKO_005 1645 CDS 100% 4.950 3.465 N ITPKB n/a
5 TRCN0000037712 CTCGCAGGTGAAGAAAGGAAT pLKO.1 1142 CDS 100% 4.950 3.465 N ITPKB n/a
6 TRCN0000197165 GACGCTGCGAAAGATCTGAAA pLKO.1 1908 CDS 100% 4.950 3.465 N ITPKB n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 5450 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 5450 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2628 CDS 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2628 CDS 100% 5.625 2.813 Y EID2B n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 9945 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10928 pDONR223 100% 88% 87.8% None (many diffs) n/a
2 ccsbBroad304_10928 pLX_304 0% 88% 87.8% V5 (many diffs) n/a
3 TRCN0000471139 GACACCTTCTTAACTGTTGTGGTC pLX_317 22.2% 88% 87.8% V5 (many diffs) n/a
4 ccsbBroadEn_14677 pDONR223 0% 88% 87.8% None (many diffs) n/a
5 ccsbBroad304_14677 pLX_304 33.2% 88% 87.8% V5 (many diffs) n/a
6 TRCN0000491832 AAATGGCACGCTTGATCTCGCTGT pLX_317 21.4% 88% 87.8% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 8.5% 6.5% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 8.5% 6.5% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 8.5% 6.5% V5 (many diffs) n/a
10 ccsbBroadEn_11616 pDONR223 100% 7.8% 7.2% None (many diffs) n/a
11 ccsbBroad304_11616 pLX_304 0% 7.8% 7.2% V5 (many diffs) n/a
12 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 7.8% 7.2% V5 (many diffs) n/a
Download CSV