Transcript: Human XM_017002653.1

PREDICTED: Homo sapiens MAPK interacting serine/threonine kinase 1 (MKNK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MKNK1 (8569)
Length:
2988
CDS:
537..1820

Additional Resources:

NCBI RefSeq record:
XM_017002653.1
NBCI Gene record:
MKNK1 (8569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314869 TGCTCCAGTCACACCTTATAG pLKO_005 1823 3UTR 100% 13.200 9.240 N MKNK1 n/a
2 TRCN0000314870 ACTTGGGCAGTGGGATGAAAC pLKO_005 1123 CDS 100% 10.800 7.560 N MKNK1 n/a
3 TRCN0000006231 CCAGCAAAGATGATACCTTAA pLKO.1 2533 3UTR 100% 10.800 7.560 N MKNK1 n/a
4 TRCN0000195111 CTGAAATGTATCCCTCGTTTA pLKO.1 2428 3UTR 100% 10.800 7.560 N MKNK1 n/a
5 TRCN0000197278 GCTGCTAAAGTCAGTAGTATC pLKO.1 2470 3UTR 100% 10.800 7.560 N MKNK1 n/a
6 TRCN0000006233 CAGCACGAAGAGAACGAACTA pLKO.1 1662 CDS 100% 4.950 3.465 N MKNK1 n/a
7 TRCN0000195356 CATCTCCAGTGAAGCCAAAGA pLKO.1 1448 CDS 100% 4.950 3.465 N MKNK1 n/a
8 TRCN0000199013 CAGGCCACATTCTACGACAAG pLKO.1 1242 CDS 100% 4.050 2.835 N MKNK1 n/a
9 TRCN0000197219 GCAGTTAGATAGTGCTCTGTG pLKO.1 2747 3UTR 100% 4.050 2.835 N MKNK1 n/a
10 TRCN0000006232 GCTGTATCAGTGTCAGGGAAA pLKO.1 836 CDS 100% 4.050 2.835 N MKNK1 n/a
11 TRCN0000195229 CTTGCTCTTCTTTCTAGAATG pLKO.1 2596 3UTR 100% 10.800 6.480 N MKNK1 n/a
12 TRCN0000314868 GCATCCAGGAAGGCAAGTATG pLKO_005 1402 CDS 100% 10.800 6.480 N MKNK1 n/a
13 TRCN0000006234 GCCAGGAAAGTTTGAAGATAT pLKO.1 763 CDS 100% 13.200 9.240 N MKNK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488574 GAGAACACTACTATTCATTTGGTT pLX_317 22.3% 84.6% 80.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487784 CACAGGGCATCCGCATTTATCAGC pLX_317 24.2% 79.4% 61.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14905 pLX_304 42.9% 77.1% 24.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14905 pDONR223 100% 77% 24.8% None (many diffs) n/a
5 TRCN0000474479 AATATATGGTTTCTGATGTGGAAT pLX_317 29.1% 77% 24.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV