Transcript: Human XM_017003581.2

PREDICTED: Homo sapiens erb-b2 receptor tyrosine kinase 4 (ERBB4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERBB4 (2066)
Length:
11907
CDS:
53..4009

Additional Resources:

NCBI RefSeq record:
XM_017003581.2
NBCI Gene record:
ERBB4 (2066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162372 CTGGTGTGTCCAGATAGCTA pXPR_003 AGG 2560 65% 21 1.0395 ERBB4 ERBB4 76195
2 BRDN0001162324 ATAGAGTACTCTTCCACCAA pXPR_003 TGG 1348 34% 12 0.9614 ERBB4 ERBB4 76198
3 BRDN0001149467 ATGTCCAGATGGCTTACAGG pXPR_003 GGG 1870 47% 16 0.7151 ERBB4 ERBB4 76196
4 BRDN0001146197 AGCGGCGACACGACAGACAT pXPR_003 TGG 1637 41% 14 0.0737 ERBB4 ERBB4 76197
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314629 GCATTGGATAATCCCGAATAT pLKO_005 3626 CDS 100% 13.200 18.480 N ERBB4 n/a
2 TRCN0000196347 GAGCAAGAATTGACTCGAATA pLKO.1 3243 CDS 100% 10.800 15.120 N ERBB4 n/a
3 TRCN0000039690 CCAGAGAAACTGAACGTCTTT pLKO.1 1286 CDS 100% 4.950 6.930 N ERBB4 n/a
4 TRCN0000009836 GATAACCAGCATTGAGCACAA pLKO.1 244 CDS 100% 4.050 5.670 N ERBB4 n/a
5 TRCN0000023460 GCCTCTGGAGAATTTACGCAT pLKO.1 343 CDS 100% 2.640 3.696 N Gm1295 n/a
6 TRCN0000194853 CGATATGCCTTGGCAATATTT pLKO.1 392 CDS 100% 15.000 12.000 N ERBB4 n/a
7 TRCN0000001411 GCGCAGGAAACATCTATATTA pLKO.1 1491 CDS 100% 15.000 12.000 N ERBB4 n/a
8 TRCN0000314626 GCGCAGGAAACATCTATATTA pLKO_005 1491 CDS 100% 15.000 12.000 N ERBB4 n/a
9 TRCN0000379973 AGAGTTGGTGGAACCATTAAC pLKO_005 2206 CDS 100% 13.200 10.560 N ERBB4 n/a
10 TRCN0000023395 CCCTCAAAGATACCTAGTTAT pLKO.1 3070 CDS 100% 13.200 10.560 N LOC241079 n/a
11 TRCN0000379530 ACGACTCGTTCATCGGGATTT pLKO_005 2641 CDS 100% 10.800 8.640 N ERBB4 n/a
12 TRCN0000039689 GCCCGTAATGTCTTAGTGAAA pLKO.1 2666 CDS 100% 4.950 3.960 N ERBB4 n/a
13 TRCN0000314630 CTGGAGAATTTACGCATTATT pLKO_005 347 CDS 100% 15.000 10.500 N ERBB4 n/a
14 TRCN0000382311 ATCAAGCTCAACTTCGTATTT pLKO_005 2247 CDS 100% 13.200 9.240 N ERBB4 n/a
15 TRCN0000314628 CAGAGATGCAATGATAGTTAT pLKO_005 4134 3UTR 100% 13.200 9.240 N ERBB4 n/a
16 TRCN0000196519 GCCAGCACATTATCTTCATAT pLKO.1 5284 3UTR 100% 13.200 9.240 N ERBB4 n/a
17 TRCN0000314627 TGATTGCAGCTGGAGTAATTG pLKO_005 2085 CDS 100% 13.200 9.240 N ERBB4 n/a
18 TRCN0000381480 ACGAGCACAAGGATAACATTG pLKO_005 2556 CDS 100% 10.800 7.560 N ERBB4 n/a
19 TRCN0000001410 CCTGTGGCTATTAAGATTCTT pLKO.1 2369 CDS 100% 5.625 3.938 N ERBB4 n/a
20 TRCN0000018328 CAGACTACCTGCAGGAGTACA pLKO.1 3849 CDS 100% 4.950 3.465 N ERBB4 n/a
21 TRCN0000001409 CCCAAACAAGAATACCTGAAT pLKO.1 3554 CDS 100% 4.950 3.465 N ERBB4 n/a
22 TRCN0000023408 GCACCCAATCAAGCTCAACTT pLKO.1 2240 CDS 100% 4.950 3.465 N Erbb4 n/a
23 TRCN0000001408 GCCACCAAACATGACTGACTT pLKO.1 1351 CDS 100% 4.950 3.465 N ERBB4 n/a
24 TRCN0000039691 GCCGAGGATGAGTATGTGAAT pLKO.1 3674 CDS 100% 4.950 3.465 N ERBB4 n/a
25 TRCN0000010345 CAGTTCTCTGTGGTTCAGGAA pLKO.1 4965 3UTR 100% 2.640 1.848 N ERBB4 n/a
26 TRCN0000001407 GCTAAGATAAAGACTGTGGAA pLKO.1 5206 3UTR 100% 2.640 1.848 N ERBB4 n/a
27 TRCN0000039692 CCAGAACAAATTCCTTTGTTA pLKO.1 502 CDS 100% 0.563 0.394 N ERBB4 n/a
28 TRCN0000039688 AGTTCTCTGTGGTTCAGGAAC pLKO.1 4966 3UTR 100% 2.640 1.848 N ERBB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14633 pDONR223 0% 96.8% 96.8% None 557_634del;3213_3214ins48 n/a
2 ccsbBroad304_14633 pLX_304 0% 96.8% 96.8% V5 557_634del;3213_3214ins48 n/a
3 TRCN0000480991 TGCACGGACTTGATTTCCTAAATA pLX_317 9.9% 96.8% 96.8% V5 557_634del;3213_3214ins48;3953_3954delTG n/a
4 TRCN0000488897 CTGCGATCTAATACCCTCCTTAAG pLX_317 8.7% 96.8% 96.8% V5 (not translated due to prior stop codon) 557_634del;3213_3214ins48 n/a
5 TRCN0000488250 AACCAACTACTCAGGGACGGGAAA pLX_317 7.1% 96.8% 96.8% V5 557_634del;3213_3214ins48;3954G>C n/a
6 TRCN0000491781 GATCGAATTTTATTGGACAGATTC pLX_317 20.7% 45.2% .3% V5 (not translated due to prior stop codon) 1_2143del;3213_3214ins48;3225A>G n/a
Download CSV