Transcript: Human XM_017003742.2

PREDICTED: Homo sapiens protein kinase D3 (PRKD3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKD3 (23683)
Length:
4105
CDS:
392..2545

Additional Resources:

NCBI RefSeq record:
XM_017003742.2
NBCI Gene record:
PRKD3 (23683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024188 GCATTGGAGAACGTTACATTA pLKO.1 2412 CDS 100% 13.200 18.480 N Prkd3 n/a
2 TRCN0000024187 GCATTTATGTACCCACCAAAT pLKO.1 2240 CDS 100% 10.800 15.120 N Prkd3 n/a
3 TRCN0000001412 CGGGAAACTGAATAATAAGAA pLKO.1 2710 3UTR 100% 5.625 7.875 N PRKD3 n/a
4 TRCN0000318531 CGGGAAACTGAATAATAAGAA pLKO_005 2710 3UTR 100% 5.625 7.875 N PRKD3 n/a
5 TRCN0000196249 GCAATAATATTCCGCTAATGA pLKO.1 1056 CDS 100% 5.625 7.875 N PRKD3 n/a
6 TRCN0000195275 CACTTCATTATGGCTCCTAAT pLKO.1 2498 CDS 100% 10.800 8.640 N PRKD3 n/a
7 TRCN0000318590 CACTTCATTATGGCTCCTAAT pLKO_005 2498 CDS 100% 10.800 8.640 N PRKD3 n/a
8 TRCN0000196715 GTGAAGCAATTGATCTGATAA pLKO.1 2280 CDS 100% 13.200 9.240 N PRKD3 n/a
9 TRCN0000196960 GTGGATTCTTTGGCATGTATG pLKO.1 116 5UTR 100% 10.800 7.560 N PRKD3 n/a
10 TRCN0000001415 CCAGGAACCAAGTAAGAGAAT pLKO.1 601 CDS 100% 4.950 3.465 N PRKD3 n/a
11 TRCN0000318588 CCAGGAACCAAGTAAGAGAAT pLKO_005 601 CDS 100% 4.950 3.465 N PRKD3 n/a
12 TRCN0000001413 CGAGTCTTTGTAGTAATGGAA pLKO.1 1811 CDS 100% 3.000 2.100 N PRKD3 n/a
13 TRCN0000318589 CGAGTCTTTGTAGTAATGGAA pLKO_005 1811 CDS 100% 3.000 2.100 N PRKD3 n/a
14 TRCN0000001416 CAGGACTATCAGACTTGGCTT pLKO.1 2369 CDS 100% 2.640 1.848 N PRKD3 n/a
15 TRCN0000349631 CAGGACTATCAGACTTGGCTT pLKO_005 2369 CDS 100% 2.640 1.848 N PRKD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491418 CGTGTGCGTCACAACTAAGAGGCT pLX_317 15.3% 80.4% 80.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489087 ACCCGAAGAGGCTTTAATACACGG pLX_317 13.8% 80.3% 80.3% V5 (many diffs) n/a
3 ccsbBroadEn_14093 pDONR223 100% 48.6% 47.1% None (many diffs) n/a
4 ccsbBroadEn_15023 pDONR223 0% 48.5% 46.7% None (many diffs) n/a
5 ccsbBroad304_15023 pLX_304 0% 48.5% 46.7% V5 (many diffs) n/a
Download CSV