Transcript: Human XM_017006218.1

PREDICTED: Homo sapiens EPH receptor A6 (EPHA6), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA6 (285220)
Length:
14514
CDS:
19..1683

Additional Resources:

NCBI RefSeq record:
XM_017006218.1
NBCI Gene record:
EPHA6 (285220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146068 AGAACTGCGACAGGATACAG pXPR_003 TGG 122 7% 2 0.5416 EPHA6 EPHA6 76249
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195154 CTCGGAATATACTGGTCAATA pLKO.1 974 CDS 100% 13.200 18.480 N EPHA6 n/a
2 TRCN0000001768 GCTCGGAATATACTGGTCAAT pLKO.1 973 CDS 100% 4.950 6.930 N EPHA6 n/a
3 TRCN0000196394 GTAATGATTGTGGTGGAATAT pLKO.1 811 CDS 100% 13.200 9.240 N EPHA6 n/a
4 TRCN0000001770 CGTCATCCTCACTTTATTCTT pLKO.1 258 CDS 100% 5.625 3.938 N EPHA6 n/a
5 TRCN0000195212 CTTTCTGATATGGGTTATGTT pLKO.1 937 CDS 100% 5.625 3.938 N EPHA6 n/a
6 TRCN0000194829 CCAAACATCATTCGCCTAGAA pLKO.1 640 CDS 100% 4.950 3.465 N EPHA6 n/a
7 TRCN0000195213 CAACTTAGTATGCAAAGTTTC pLKO.1 996 CDS 100% 1.080 0.756 N EPHA6 n/a
8 TRCN0000195580 CAGCAGAACAAGGACAGATTC pLKO.1 197 CDS 100% 10.800 6.480 N EPHA6 n/a
9 TRCN0000196374 GCATCAGGCATGAAGTATCTT pLKO.1 919 CDS 100% 5.625 3.375 N EPHA6 n/a
10 TRCN0000001771 GCAGCAGAACAAGGACAGATT pLKO.1 196 CDS 100% 4.950 2.970 N EPHA6 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7327 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7327 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489808 GCGAATCGTGCGTGGGCGGTAGCG pLX_317 35% 60.3% 54.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489560 TTCAAGTCGTGCGGGCTTGCCTCT pLX_317 32.2% 57.8% 54.6% V5 (many diffs) n/a
3 ccsbBroadEn_15300 pDONR223 0% 49% 48.9% None 0_1ins1723;3_4insAGAAA n/a
4 ccsbBroad304_15300 pLX_304 0% 49% 48.9% V5 0_1ins1723;3_4insAGAAA n/a
Download CSV