Transcript: Human XM_017009848.1

PREDICTED: Homo sapiens cyclin J like (CCNJL), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNJL (79616)
Length:
3315
CDS:
636..1589

Additional Resources:

NCBI RefSeq record:
XM_017009848.1
NBCI Gene record:
CCNJL (79616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425714 CCACTTCATGGATCGCTACAA pLKO_005 629 5UTR 100% 4.950 6.930 N CCNJL n/a
2 TRCN0000158409 CCTCAAGGAGTATGCCCATTA pLKO.1 965 CDS 100% 10.800 7.560 N CCNJL n/a
3 TRCN0000156748 GTCACCCTGCAAGATCACATA pLKO.1 996 CDS 100% 4.950 3.465 N CCNJL n/a
4 TRCN0000158129 CTGCATCCCTTAGCATGCATA pLKO.1 1468 CDS 100% 0.495 0.347 N CCNJL n/a
5 TRCN0000157639 CCTTAGCATGCATATGGCCAT pLKO.1 1475 CDS 100% 0.000 0.000 N CCNJL n/a
6 TRCN0000447152 GAGCACCTCAGCACGTGTATT pLKO_005 1134 CDS 100% 13.200 7.920 N CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12574 pDONR223 100% 86.8% 86.5% None 70_71ins144 n/a
2 ccsbBroad304_12574 pLX_304 0% 86.8% 86.5% V5 70_71ins144 n/a
3 TRCN0000470812 GGCTGATGGTCTAGTTTCTTTACA pLX_317 35.9% 86.8% 86.5% V5 70_71ins144 n/a
4 ccsbBroadEn_12573 pDONR223 100% 38.1% 38.1% None 1_588del n/a
5 ccsbBroad304_12573 pLX_304 0% 38.1% 38.1% V5 1_588del n/a
6 TRCN0000473352 ATGACTCTTGTCATTTAACGATTG pLX_317 100% 38.1% 38.1% V5 1_588del n/a
Download CSV