Transcript: Human XM_017010248.1

PREDICTED: Homo sapiens collagen type X alpha 1 chain (COL10A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL10A1 (1300)
Length:
6750
CDS:
3544..5586

Additional Resources:

NCBI RefSeq record:
XM_017010248.1
NBCI Gene record:
COL10A1 (1300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082798 CCTCACTTATTAAAGCACAAA pLKO.1 6564 3UTR 100% 4.950 6.930 N COL10A1 n/a
2 TRCN0000082802 CCGAGTCAAATGGCCTATACT pLKO.1 5513 CDS 100% 5.625 4.500 N COL10A1 n/a
3 TRCN0000415520 CATCCAGGAGGTATCATATAA pLKO_005 6018 3UTR 100% 15.000 10.500 N COL10A1 n/a
4 TRCN0000082799 CCCTACACCATAAAGAGTAAA pLKO.1 3676 CDS 100% 13.200 9.240 N COL10A1 n/a
5 TRCN0000417638 GATTTGAGAAACTCGGCATTT pLKO_005 5946 3UTR 100% 10.800 7.560 N COL10A1 n/a
6 TRCN0000082800 CCTGTAATGTACACCTATGAT pLKO.1 5401 CDS 100% 5.625 3.938 N COL10A1 n/a
7 TRCN0000082801 GCATCAAAGGTGATAGAGGTT pLKO.1 4238 CDS 100% 2.640 1.848 N COL10A1 n/a
8 TRCN0000430740 GATACCAGGAATATACTATTT pLKO_005 5319 CDS 100% 13.200 7.920 N COL10A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00343 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00343 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477340 GACGGATTCTGTAATGGCCCATTT pLX_317 22.1% 100% 100% V5 n/a
Download CSV