Transcript: Human XM_017010875.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 5 (MAP3K5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K5 (4217)
Length:
5412
CDS:
357..4700

Additional Resources:

NCBI RefSeq record:
XM_017010875.1
NBCI Gene record:
MAP3K5 (4217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431592 GCACTCCTTCATCGAGCTATT pLKO_005 4377 CDS 100% 10.800 15.120 N MAP3K5 n/a
2 TRCN0000416310 GCAAATACTGGAAGGATTAAA pLKO_005 2930 CDS 100% 15.000 10.500 N MAP3K5 n/a
3 TRCN0000219666 ATTCGGCAGCGAGTAGATAAT pLKO.1 1578 CDS 100% 13.200 9.240 N MAP3K5 n/a
4 TRCN0000219665 CAGTACTTCCGGGAATCTATA pLKO.1 1491 CDS 100% 13.200 9.240 N MAP3K5 n/a
5 TRCN0000419788 GCTCTTTCAGCTGGATCAAAT pLKO_005 3432 CDS 100% 13.200 9.240 N MAP3K5 n/a
6 TRCN0000427691 TAAAGTTCTTCGGAATCATAA pLKO_005 3992 CDS 100% 13.200 9.240 N MAP3K5 n/a
7 TRCN0000195438 CCTTGCATCTGAGAGTGATAC pLKO.1 4112 CDS 100% 10.800 7.560 N MAP3K5 n/a
8 TRCN0000419570 GCTATTGCACTTCAGCCAAAT pLKO_005 5000 3UTR 100% 10.800 7.560 N MAP3K5 n/a
9 TRCN0000000992 CGGGACATAAAGGGTGACAAT pLKO.1 2979 CDS 100% 4.950 3.465 N MAP3K5 n/a
10 TRCN0000000995 CTGCGGAGAAAGAGATGTCAA pLKO.1 3587 CDS 100% 4.950 3.465 N MAP3K5 n/a
11 TRCN0000000991 TGTTTAGGCTTCTGTGTGTTT pLKO.1 5098 3UTR 100% 4.950 3.465 N MAP3K5 n/a
12 TRCN0000000994 GAAGACACTATAAGCCGGTTT pLKO.1 4545 CDS 100% 4.050 2.835 N MAP3K5 n/a
13 TRCN0000000993 GCTTACCTCTTGTGGATCGTT pLKO.1 1432 CDS 100% 3.000 2.100 N MAP3K5 n/a
14 TRCN0000194958 CCAGTATTTGTTTACTCATGT pLKO.1 4809 3UTR 100% 4.950 2.970 N MAP3K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488094 ACGAATCAGCTTAATCGTCTTCTC pLX_317 7.5% 90.2% 90.2% V5 (not translated due to prior stop codon) 1_327del;1884A>G;2007_2008ins108 n/a
2 TRCN0000488584 TTACTGGCCTAATCGATGTGTGTT pLX_317 7.8% 90.1% 90.1% V5 (many diffs) n/a
3 ccsbBroadEn_14695 pDONR223 10.9% 84.5% 2.8% None (many diffs) n/a
4 ccsbBroad304_14695 pLX_304 10.4% 84.5% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000467146 TCTTGTTAAGTTATAACTTGTTTC pLX_317 8.2% 84.5% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV