Transcript: Human XM_017012544.1

PREDICTED: Homo sapiens cytochrome P450 family 3 subfamily A member 43 (CYP3A43), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP3A43 (64816)
Length:
2309
CDS:
90..1172

Additional Resources:

NCBI RefSeq record:
XM_017012544.1
NBCI Gene record:
CYP3A43 (64816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423887 TGACAAATCAATGCCAAATAA pLKO_005 1374 3UTR 100% 15.000 10.500 N CYP3A43 n/a
2 TRCN0000435039 ATGTAATCACTGGCACATTAT pLKO_005 202 CDS 100% 13.200 9.240 N CYP3A43 n/a
3 TRCN0000064256 CCACTGAAATTAGACAATCTA pLKO.1 1080 CDS 100% 5.625 3.938 N CYP3A43 n/a
4 TRCN0000064255 GCAGTGATGGTTCCAATCTAT pLKO.1 834 CDS 100% 5.625 3.938 N CYP3A43 n/a
5 TRCN0000064257 CCAAAGAAACAAAGTCCCATA pLKO.1 499 CDS 100% 4.050 2.835 N CYP3A43 n/a
6 TRCN0000064253 CCCTGAAAGTAGGTTCAGTAA pLKO.1 902 CDS 100% 0.495 0.347 N CYP3A43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12497 pDONR223 100% 82% 67.9% None (many diffs) n/a
2 ccsbBroad304_12497 pLX_304 0% 82% 67.9% V5 (many diffs) n/a
3 TRCN0000491812 GATAGCCAGTTTGCATAGCTTGAA pLX_317 39.2% 82% 67.9% V5 (many diffs) n/a
4 ccsbBroadEn_00411 pDONR223 100% 60.4% 54.3% None (many diffs) n/a
5 ccsbBroad304_00411 pLX_304 0% 60.4% 54.3% V5 (many diffs) n/a
6 TRCN0000477588 ATCTATTATTTATGACGGCGACCT pLX_317 35.4% 60.4% 54.3% V5 (many diffs) n/a
Download CSV