Transcript: Human XM_017013205.2

PREDICTED: Homo sapiens EYA transcriptional coactivator and phosphatase 1 (EYA1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EYA1 (2138)
Length:
3455
CDS:
313..2124

Additional Resources:

NCBI RefSeq record:
XM_017013205.2
NBCI Gene record:
EYA1 (2138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083446 CGACGGGTCTTTAAACAATTT pLKO.1 570 CDS 100% 13.200 18.480 N EYA1 n/a
2 TRCN0000315624 CGACGGGTCTTTAAACAATTT pLKO_005 570 CDS 100% 13.200 18.480 N EYA1 n/a
3 TRCN0000303461 TCCCAATGGCACCGAAGTTAA pLKO_005 507 CDS 100% 13.200 18.480 N EYA1 n/a
4 TRCN0000366189 TCCCAATGGCACCGAAGTTAA pLKO_005 507 CDS 100% 13.200 18.480 N Eya1 n/a
5 TRCN0000083445 GCCGAAGAAACAATAATCCTT pLKO.1 1319 CDS 100% 3.000 4.200 N EYA1 n/a
6 TRCN0000083447 CGGACAAACTGTGTGAATATT pLKO.1 1873 CDS 100% 15.000 12.000 N EYA1 n/a
7 TRCN0000083444 CCCGGACAAACTGTGTGAATA pLKO.1 1871 CDS 100% 13.200 10.560 N EYA1 n/a
8 TRCN0000303462 AGCCCATCAACACCCATTAAA pLKO_005 1243 CDS 100% 15.000 10.500 N EYA1 n/a
9 TRCN0000369592 CAGCAACCAGTGCTAACTTAT pLKO_005 1634 CDS 100% 13.200 9.240 N EYA1 n/a
10 TRCN0000310704 TGCAGTTGAGGGCCGAAATTG pLKO_005 1793 CDS 100% 13.200 9.240 N EYA1 n/a
11 TRCN0000029846 CCTCACAAACTATGGCTGCAT pLKO.1 704 CDS 100% 2.640 1.848 N Eya1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06185 pDONR223 100% 91.8% 91.4% None (many diffs) n/a
2 ccsbBroad304_06185 pLX_304 0% 91.8% 91.4% V5 (many diffs) n/a
3 TRCN0000473328 TCGCTGCCATAGAGTGCTCGAAGA pLX_317 23.9% 91.8% 91.4% V5 (many diffs) n/a
4 ccsbBroadEn_10813 pDONR223 100% 78.7% 75.7% None (many diffs) n/a
5 ccsbBroad304_10813 pLX_304 0% 78.7% 75.7% V5 (many diffs) n/a
6 TRCN0000478121 CATCTAAAGTACTTAAGGTCTCCA pLX_317 12.8% 78.7% 75.7% V5 (many diffs) n/a
Download CSV