Transcript: Human XM_017019830.2

PREDICTED: Homo sapiens arginine and serine rich coiled-coil 2 (RSRC2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSRC2 (65117)
Length:
2162
CDS:
147..1361

Additional Resources:

NCBI RefSeq record:
XM_017019830.2
NBCI Gene record:
RSRC2 (65117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128445 GAGCGACTAAATTCATCTGAA pLKO.1 444 CDS 100% 4.950 6.930 N RSRC2 n/a
2 TRCN0000131075 GCATGGGTGTTGCATTGACTT pLKO.1 1450 3UTR 100% 4.950 6.930 N RSRC2 n/a
3 TRCN0000130541 GCTCAGTATGAAATGGCAAGA pLKO.1 1269 CDS 100% 4.050 5.670 N RSRC2 n/a
4 TRCN0000352934 GCTCAGTATGAAATGGCAAGA pLKO_005 1269 CDS 100% 4.050 5.670 N RSRC2 n/a
5 TRCN0000370008 AGTGTTGTAATCAGGTTAAAC pLKO_005 1526 3UTR 100% 13.200 9.240 N RSRC2 n/a
6 TRCN0000343543 CTATAACCCAGCCGCTGTTAA pLKO_005 1097 CDS 100% 13.200 9.240 N RSRC2 n/a
7 TRCN0000343544 TGTAAAGTTTGGGACTTATAG pLKO_005 1375 3UTR 100% 13.200 9.240 N RSRC2 n/a
8 TRCN0000129227 CACATCTTCAATGCGAGGAAT pLKO.1 1328 CDS 100% 4.950 3.465 N RSRC2 n/a
9 TRCN0000343491 CACATCTTCAATGCGAGGAAT pLKO_005 1328 CDS 100% 4.950 3.465 N RSRC2 n/a
10 TRCN0000131080 GTCACGTCCTTGTTCACCAAA pLKO.1 1411 3UTR 100% 4.950 3.465 N RSRC2 n/a
11 TRCN0000130540 GTGAAGATGAAGCTGGATGTA pLKO.1 1183 CDS 100% 4.950 3.465 N RSRC2 n/a
12 TRCN0000370009 GGAAGAAGTATTTCGAAATTT pLKO_005 1244 CDS 100% 15.000 9.000 N RSRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489543 ACACCATGAACCACCTGATCTCCA pLX_317 28.9% 86.6% V5 (not translated due to prior stop codon) 0_1ins96;671C>G;1034_1035ins90 n/a
Download CSV