Transcript: Human XM_017021590.1

PREDICTED: Homo sapiens acyl-CoA thioesterase 1 (ACOT1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOT1 (641371)
Length:
1092
CDS:
52..948

Additional Resources:

NCBI RefSeq record:
XM_017021590.1
NBCI Gene record:
ACOT1 (641371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256059 TGATGGCTCTGGCTTACTATA pLKO_005 236 CDS 100% 13.200 7.920 N ACOT1 n/a
2 TRCN0000180665 GCTCAGTCATCCTGAGGTAAA pLKO.1 327 CDS 100% 1.080 0.648 N ACOT1 n/a
3 TRCN0000256060 CCAGAGACAGGGCACTATATT pLKO_005 748 CDS 100% 15.000 7.500 Y ACOT1 n/a
4 TRCN0000256062 CTTGGTGGGCAGTCCTATTAT pLKO_005 810 CDS 100% 15.000 7.500 Y ACOT1 n/a
5 TRCN0000256061 TATGCTAATGAGGCCTGTAAA pLKO_005 682 CDS 100% 13.200 6.600 Y ACOT1 n/a
6 TRCN0000256063 CGCTCCATCTGGAGTACTTTG pLKO_005 287 CDS 100% 10.800 5.400 Y ACOT1 n/a
7 TRCN0000048888 CCTGACCAGAAGAGCTTCATT pLKO.1 589 CDS 100% 5.625 2.813 Y ACOT2 n/a
8 TRCN0000048891 CGTCAACAGAAATCGCATCAA pLKO.1 510 CDS 100% 4.950 2.475 Y ACOT2 n/a
9 TRCN0000174083 CGTCAACAGAAATCGCATCAA pLKO.1 510 CDS 100% 4.950 2.475 Y ACOT2 n/a
10 TRCN0000179740 CGTCAACAGAAATCGCATCAA pLKO.1 510 CDS 100% 4.950 2.475 Y ACOT1 n/a
11 TRCN0000048889 GCACTATATTGAGCCTCCTTA pLKO.1 759 CDS 100% 4.950 2.475 Y ACOT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11575 pDONR223 100% 68.4% 65.1% None (many diffs) n/a
2 ccsbBroad304_11575 pLX_304 0% 68.4% 65.1% V5 (many diffs) n/a
3 TRCN0000474153 TCGCATTATGGCTAGCACCCCGAG pLX_317 29.2% 68.4% 65.1% V5 (many diffs) n/a
4 ccsbBroadEn_05709 pDONR223 100% 67.7% 65.6% None (many diffs) n/a
5 ccsbBroad304_05709 pLX_304 0% 67.7% 65.6% V5 (many diffs) n/a
6 TRCN0000471582 GGATCAACTACTTCAAAAATGGGA pLX_317 37% 67.7% 65.6% V5 (many diffs) n/a
7 ccsbBroadEn_14981 pDONR223 61.1% 59.5% 56.3% None (many diffs) n/a
8 ccsbBroad304_14981 pLX_304 0% 59.5% 56.3% V5 (many diffs) n/a
Download CSV