Transcript: Human XM_017021591.1

PREDICTED: Homo sapiens acyl-CoA thioesterase 1 (ACOT1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOT1 (641371)
Length:
1575
CDS:
652..1431

Additional Resources:

NCBI RefSeq record:
XM_017021591.1
NBCI Gene record:
ACOT1 (641371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256059 TGATGGCTCTGGCTTACTATA pLKO_005 719 CDS 100% 13.200 7.920 N ACOT1 n/a
2 TRCN0000180665 GCTCAGTCATCCTGAGGTAAA pLKO.1 810 CDS 100% 1.080 0.648 N ACOT1 n/a
3 TRCN0000256060 CCAGAGACAGGGCACTATATT pLKO_005 1231 CDS 100% 15.000 7.500 Y ACOT1 n/a
4 TRCN0000256062 CTTGGTGGGCAGTCCTATTAT pLKO_005 1293 CDS 100% 15.000 7.500 Y ACOT1 n/a
5 TRCN0000436145 ACCCTTGATCCGTGATCATTT pLKO_005 147 5UTR 100% 13.200 6.600 Y RIOX1 n/a
6 TRCN0000256061 TATGCTAATGAGGCCTGTAAA pLKO_005 1165 CDS 100% 13.200 6.600 Y ACOT1 n/a
7 TRCN0000256063 CGCTCCATCTGGAGTACTTTG pLKO_005 770 CDS 100% 10.800 5.400 Y ACOT1 n/a
8 TRCN0000048888 CCTGACCAGAAGAGCTTCATT pLKO.1 1072 CDS 100% 5.625 2.813 Y ACOT2 n/a
9 TRCN0000048891 CGTCAACAGAAATCGCATCAA pLKO.1 993 CDS 100% 4.950 2.475 Y ACOT2 n/a
10 TRCN0000174083 CGTCAACAGAAATCGCATCAA pLKO.1 993 CDS 100% 4.950 2.475 Y ACOT2 n/a
11 TRCN0000179740 CGTCAACAGAAATCGCATCAA pLKO.1 993 CDS 100% 4.950 2.475 Y ACOT1 n/a
12 TRCN0000048889 GCACTATATTGAGCCTCCTTA pLKO.1 1242 CDS 100% 4.950 2.475 Y ACOT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05709 pDONR223 100% 61.5% 61.5% None 0_1ins486 n/a
2 ccsbBroad304_05709 pLX_304 0% 61.5% 61.5% V5 0_1ins486 n/a
3 TRCN0000471582 GGATCAACTACTTCAAAAATGGGA pLX_317 37% 61.5% 61.5% V5 0_1ins486 n/a
4 ccsbBroadEn_11575 pDONR223 100% 61.1% 61% None (many diffs) n/a
5 ccsbBroad304_11575 pLX_304 0% 61.1% 61% V5 (many diffs) n/a
6 TRCN0000474153 TCGCATTATGGCTAGCACCCCGAG pLX_317 29.2% 61.1% 61% V5 (many diffs) n/a
7 ccsbBroadEn_14981 pDONR223 61.1% 53.1% 52.5% None (many diffs) n/a
8 ccsbBroad304_14981 pLX_304 0% 53.1% 52.5% V5 (many diffs) n/a
Download CSV