Transcript: Human XM_017024841.1

PREDICTED: Homo sapiens protein kinase C alpha (PRKCA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCA (5578)
Length:
1498
CDS:
213..1187

Additional Resources:

NCBI RefSeq record:
XM_017024841.1
NBCI Gene record:
PRKCA (5578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233511 ACCATCCGCTCCACACTAAAT pLKO_005 852 CDS 100% 13.200 9.240 N PRKCA n/a
2 TRCN0000001692 CATGGAACTCAGGCAGAAATT pLKO.1 1106 CDS 100% 13.200 9.240 N PRKCA n/a
3 TRCN0000195322 CGAGGTGAAGGACCACAAATT pLKO.1 308 CDS 100% 13.200 9.240 N PRKCA n/a
4 TRCN0000001690 CTTTGGAGTTTCGGAGCTGAT pLKO.1 992 CDS 100% 4.050 2.835 N PRKCA n/a
5 TRCN0000022874 CCTTATGTGAAGCTGAAACTA pLKO.1 792 CDS 100% 5.625 3.938 N Prkca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_01281 pLX_304 33.6% 47.2% 66.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_01281 pDONR223 100% 47.1% 45.6% None (many diffs) n/a
3 TRCN0000472511 CAAAGCGAGGGGGAGCATCGCTTC pLX_317 22.4% 47.1% 45.6% V5 (many diffs) n/a
4 TRCN0000489154 CGCAACGTCAAACTGACCTGCCAT pLX_317 20.3% 47.1% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14788 pDONR223 72.5% 46.8% 68.5% None (many diffs) n/a
6 ccsbBroad304_14788 pLX_304 26.3% 46.8% 68.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000475052 TTCAATCGGTGGGAGACCACTGAG pLX_317 18.9% 46.8% 68.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV