Transcript: Human XM_017028369.1

PREDICTED: Homo sapiens phosphofructokinase, liver type (PFKL), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKL (5211)
Length:
3154
CDS:
370..2643

Additional Resources:

NCBI RefSeq record:
XM_017028369.1
NBCI Gene record:
PFKL (5211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010111 CTTTCAACATCCACGACTTAA pLKO.1 2093 CDS 100% 13.200 18.480 N PFKL n/a
2 TRCN0000199321 CCTAGTGGGCTCCATCGATAA pLKO.1 780 CDS 100% 10.800 15.120 N PFKL n/a
3 TRCN0000199670 GCTCCATCGATAACGACTTCT pLKO.1 788 CDS 100% 4.950 6.930 N PFKL n/a
4 TRCN0000342394 GCTCCATCGATAACGACTTCT pLKO_005 788 CDS 100% 4.950 6.930 N PFKL n/a
5 TRCN0000010103 CGAGAACAACTGGAACATTTA pLKO.1 1434 CDS 100% 13.200 9.240 N PFKL n/a
6 TRCN0000342353 CGAGAACAACTGGAACATTTA pLKO_005 1434 CDS 100% 13.200 9.240 N PFKL n/a
7 TRCN0000199692 CTGAAGATGCTGGCACAATAC pLKO.1 2542 CDS 100% 10.800 7.560 N PFKL n/a
8 TRCN0000342395 CTGAAGATGCTGGCACAATAC pLKO_005 2542 CDS 100% 10.800 7.560 N PFKL n/a
9 TRCN0000199860 GCTGGCACAATACCGCATCAG pLKO.1 2550 CDS 100% 1.350 0.945 N PFKL n/a
10 TRCN0000342355 GCTGGCACAATACCGCATCAG pLKO_005 2550 CDS 100% 1.350 0.945 N PFKL n/a
11 TRCN0000199693 CGGGCTGGTGTCTTGAGACCA pLKO.1 2810 3UTR 100% 0.000 0.000 N PFKL n/a
12 TRCN0000199767 GCCAGCCCTTGCTCTACCTGG pLKO.1 2986 3UTR 100% 0.000 0.000 N PFKL n/a
13 TRCN0000196457 GCTCAAGAAAGACACTGATTT pLKO.1 2472 CDS 100% 13.200 7.920 N PFKL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491856 GGTCGCCCTAATCCGCAGAATTAT pLX_317 14.4% 96.8% 96.4% V5 (many diffs) n/a
2 ccsbBroadEn_15524 pDONR223 0% 96.8% 96.5% None (many diffs) n/a
3 ccsbBroad304_15524 pLX_304 0% 96.8% 96.5% V5 (many diffs) n/a
4 TRCN0000481270 CGAAACCAGAAGAAAAAACATGAC pLX_317 22.6% 96.8% 96.5% V5 (many diffs) n/a
5 TRCN0000489124 TAATCGTGGCGACGGTAACATTCG pLX_317 15% 96.8% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15523 pDONR223 0% 96.7% 96.2% None (many diffs) n/a
7 ccsbBroad304_15523 pLX_304 0% 96.7% 96.2% V5 (many diffs) n/a
8 ccsbBroadEn_10491 pDONR223 100% 91.4% 91.5% None 0_1ins210;297C>T n/a
9 ccsbBroad304_10491 pLX_304 0% 91.4% 91.5% V5 0_1ins210;297C>T n/a
10 TRCN0000473690 GAGTCTTACCTCTAACTGGCGGCC pLX_317 14.7% 91.4% 91.5% V5 0_1ins210;297C>T n/a
11 ccsbBroadEn_14745 pDONR223 0% 91.4% 91.5% None 0_1ins210;297C>T n/a
12 ccsbBroad304_14745 pLX_304 0% 91.4% 91.5% V5 0_1ins210;297C>T n/a
13 TRCN0000480916 TCGCACACGGACTCGTTGGGCGAT pLX_317 18% 91.4% 91.5% V5 0_1ins210;297C>T n/a
14 ccsbBroadEn_15525 pDONR223 0% 61.4% 61.4% None 1_876del n/a
15 ccsbBroad304_15525 pLX_304 0% 61.4% 61.4% V5 1_876del n/a
Download CSV