Transcript: Human XM_017029513.1

PREDICTED: Homo sapiens PAGE family member 2B (PAGE2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAGE2B (389860)
Length:
528
CDS:
88..423

Additional Resources:

NCBI RefSeq record:
XM_017029513.1
NBCI Gene record:
PAGE2B (389860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166209 CAGCCAGTTGGATCTGTGATT pLKO.1 151 CDS 100% 4.950 2.970 N PAGE2B n/a
2 TRCN0000165814 GCCAGTTGGATCTGTGATTGT pLKO.1 153 CDS 100% 4.950 2.970 N PAGE2B n/a
3 TRCN0000194309 GTGAGCATGTGAGAACAAGAT pLKO.1 92 CDS 100% 4.950 2.970 N PAGE2B n/a
4 TRCN0000420276 AGGAACCACCAACTGATAATC pLKO_005 206 CDS 100% 13.200 6.600 Y PAGE2B n/a
5 TRCN0000163252 GAGGAACCACCAACTGATAAT pLKO.1 205 CDS 100% 13.200 6.600 Y PAGE2 n/a
6 TRCN0000115698 CCAACTGATAATCAGGGTATT pLKO.1 214 CDS 100% 10.800 5.400 Y PAGE5 n/a
7 TRCN0000162688 CCAACTGATAATCAGGGTATT pLKO.1 214 CDS 100% 10.800 5.400 Y PAGE2 n/a
8 TRCN0000203992 GAACTGGCTCTGCTTAAGATA pLKO.1 307 CDS 100% 5.625 2.813 Y PAGE2B n/a
9 TRCN0000417621 AGGGCCTGACATGGAAGCTTT pLKO_005 279 CDS 100% 4.950 2.475 Y PAGE2B n/a
10 TRCN0000164911 GAAGAGGAACCACCAACTGAT pLKO.1 202 CDS 100% 4.950 2.475 Y PAGE2 n/a
11 TRCN0000162871 GAGGAAATGACCAAGAGTCTT pLKO.1 128 CDS 100% 4.950 2.475 Y PAGE2 n/a
12 TRCN0000417508 AGGAAATGACCAAGAGTCTTC pLKO_005 129 CDS 100% 4.050 2.025 Y PAGE2B n/a
13 TRCN0000164699 CAAGAAGAGGAACCACCAACT pLKO.1 199 CDS 100% 4.050 2.025 Y PAGE2B n/a
14 TRCN0000434500 GAAAGAGGAAATGACCAAGAG pLKO_005 124 CDS 100% 4.050 2.025 Y PAGE5 n/a
15 TRCN0000429899 TAATCAGGGTATTGCACCTAG pLKO_005 222 CDS 100% 4.050 2.025 Y PAGE2B n/a
16 TRCN0000164030 CTCAGAAAGAGGAAATGACCA pLKO.1 120 CDS 100% 2.640 1.320 Y PAGE2 n/a
17 TRCN0000163696 GATCTCACTAAAGTGCTGGAA pLKO.1 382 CDS 100% 2.640 1.320 Y PAGE2 n/a
18 TRCN0000115701 GCTCTGCTTAAGATAGAGGAT pLKO.1 313 CDS 100% 2.640 1.320 Y PAGE5 n/a
19 TRCN0000163253 GCTCTGCTTAAGATAGAGGAT pLKO.1 313 CDS 100% 2.640 1.320 Y PAGE2 n/a
20 TRCN0000165201 GTCAAGAAGAGGAACCACCAA pLKO.1 197 CDS 100% 2.640 1.320 Y PAGE2 n/a
21 TRCN0000163163 GATAATCAGGGTATTGCACCT pLKO.1 220 CDS 100% 2.160 1.080 Y PAGE2 n/a
22 TRCN0000161730 CAATCCTCAGAAAGAGGAAAT pLKO.1 115 CDS 100% 1.080 0.540 Y PAGE2 n/a
23 TRCN0000188423 CCACCAACTGATAATCAGGGT pLKO.1 211 CDS 100% 0.660 0.330 Y PAGE2B n/a
24 TRCN0000187284 CTTAAGATAGAGGATGAGCCT pLKO.1 319 CDS 100% 0.660 0.330 Y PAGE2B n/a
25 TRCN0000187285 CCAATCCTCAGAAAGAGGAAA pLKO.1 114 CDS 100% 0.495 0.248 Y PAGE2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05606 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05606 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_05215 pDONR223 100% 96.3% 93.6% None (many diffs) n/a
4 ccsbBroad304_05215 pLX_304 0% 96.3% 93.6% V5 (many diffs) n/a
5 TRCN0000469311 GCCGTGCCGTAAACGGACTCCATC pLX_317 100% 96.3% 93.6% V5 (many diffs) n/a
6 ccsbBroadEn_09304 pDONR223 96.8% 94.2% 88.2% None (many diffs) n/a
7 ccsbBroadEn_04529 pDONR223 100% 80.1% 74.8% None (many diffs) n/a
8 ccsbBroad304_04529 pLX_304 0% 80.1% 74.8% V5 (many diffs) n/a
9 TRCN0000468866 CTTGTTGCCGTGCCGTCGCTGGGA pLX_317 100% 80.1% 74.8% V5 (many diffs) n/a
Download CSV