Transcript: Mouse XM_017315414.1

PREDICTED: Mus musculus EYA transcriptional coactivator and phosphatase 1 (Eya1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eya1 (14048)
Length:
4348
CDS:
958..2385

Additional Resources:

NCBI RefSeq record:
XM_017315414.1
NBCI Gene record:
Eya1 (14048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366166 TCTGTACTTCGCTACTTATTT pLKO_005 2841 3UTR 100% 15.000 21.000 N Eya1 n/a
2 TRCN0000029845 CCGGACGAACTGTGTGAATAT pLKO.1 2079 CDS 100% 13.200 18.480 N Eya1 n/a
3 TRCN0000029848 CCAAACTCGATAGCTCTCATA pLKO.1 741 5UTR 100% 4.950 6.930 N Eya1 n/a
4 TRCN0000366228 AGTCCTTCCACACCCATTAAA pLKO_005 1450 CDS 100% 15.000 12.000 N Eya1 n/a
5 TRCN0000303461 TCCCAATGGCACCGAAGTTAA pLKO_005 781 5UTR 100% 13.200 10.560 N EYA1 n/a
6 TRCN0000366189 TCCCAATGGCACCGAAGTTAA pLKO_005 781 5UTR 100% 13.200 10.560 N Eya1 n/a
7 TRCN0000366164 ACCACGTCATCAGGATTATAT pLKO_005 1174 CDS 100% 15.000 10.500 N Eya1 n/a
8 TRCN0000029847 CCACGTCATCAGGATTATATT pLKO.1 1175 CDS 100% 15.000 10.500 N Eya1 n/a
9 TRCN0000374710 TGCAGCCACCAGTGCTAATTT pLKO_005 1839 CDS 100% 15.000 10.500 N Eya1 n/a
10 TRCN0000374778 ACAGCAGCAGACGGGTCTTTA pLKO_005 836 5UTR 100% 13.200 9.240 N Eya1 n/a
11 TRCN0000366165 CTTCCGCTACAGACGAGTAAA pLKO_005 1911 CDS 100% 13.200 9.240 N Eya1 n/a
12 TRCN0000029844 GATGTACCAATTTCAGCATAT pLKO.1 2476 3UTR 100% 10.800 7.560 N Eya1 n/a
13 TRCN0000374711 TTCGGCAAATGTGATACAAAC pLKO_005 2700 3UTR 100% 10.800 7.560 N Eya1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10813 pDONR223 100% 82.4% 89.5% None (many diffs) n/a
2 ccsbBroad304_10813 pLX_304 0% 82.4% 89.5% V5 (many diffs) n/a
3 TRCN0000478121 CATCTAAAGTACTTAAGGTCTCCA pLX_317 12.8% 82.4% 89.5% V5 (many diffs) n/a
4 ccsbBroadEn_06185 pDONR223 100% 72.2% 78.5% None (many diffs) n/a
5 ccsbBroad304_06185 pLX_304 0% 72.2% 78.5% V5 (many diffs) n/a
6 TRCN0000473328 TCGCTGCCATAGAGTGCTCGAAGA pLX_317 23.9% 72.2% 78.5% V5 (many diffs) n/a
Download CSV