Transcript: Mouse XM_017319695.1

PREDICTED: Mus musculus arginine/serine-rich coiled-coil 1 (Rsrc1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rsrc1 (66880)
Length:
3345
CDS:
244..1260

Additional Resources:

NCBI RefSeq record:
XM_017319695.1
NBCI Gene record:
Rsrc1 (66880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124886 AGACGTAAAGTCCGGGACAAA pLKO.1 667 CDS 100% 4.950 6.930 N Rsrc1 n/a
2 TRCN0000124887 TCTAGCTCATCCAAATCTATT pLKO.1 1152 CDS 100% 13.200 9.240 N Rsrc1 n/a
3 TRCN0000124885 CTCTAGCTCATCCAAATCTAT pLKO.1 1151 CDS 100% 5.625 3.938 N Rsrc1 n/a
4 TRCN0000124888 GCAGACATTCAGATCAAGTAA pLKO.1 981 CDS 100% 5.625 3.938 N Rsrc1 n/a
5 TRCN0000128437 GCAGACATTCAGATCAAGTAA pLKO.1 981 CDS 100% 5.625 3.938 N RSRC1 n/a
6 TRCN0000281011 GCAGACATTCAGATCAAGTAA pLKO_005 981 CDS 100% 5.625 3.938 N RSRC1 n/a
7 TRCN0000124884 CCATGCTATTAGGAAGTGTAT pLKO.1 3061 3UTR 100% 4.950 3.465 N Rsrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03283 pDONR223 100% 85.7% 90.8% None (many diffs) n/a
2 ccsbBroad304_03283 pLX_304 0% 85.7% 90.8% V5 (many diffs) n/a
3 TRCN0000465673 AAAGGGTATCAGTCACCATAACAA pLX_317 29.2% 85.7% 90.8% V5 (many diffs) n/a
4 ccsbBroadEn_15837 pDONR223 0% 71.4% 75.1% None (many diffs) n/a
5 ccsbBroad304_15837 pLX_304 0% 71.4% 75.1% V5 (many diffs) n/a
6 TRCN0000473767 CCCCACCGGGTTAAATCTTCCTCC pLX_317 10.8% 71.4% 75.1% V5 (many diffs) n/a
Download CSV