Transcript: Mouse XM_017320432.1

PREDICTED: Mus musculus FGGY carbohydrate kinase domain containing (Fggy), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fggy (75578)
Length:
1315
CDS:
149..1180

Additional Resources:

NCBI RefSeq record:
XM_017320432.1
NBCI Gene record:
Fggy (75578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078669 GCCAGAGTATATATGCATATT pLKO.1 600 CDS 100% 13.200 18.480 N FGGY n/a
2 TRCN0000025005 CCAGAAGGAGTATTCAGCAAT pLKO.1 1144 CDS 100% 4.950 3.465 N Fggy n/a
3 TRCN0000025007 CCTGCCTTTCCTGAACTACAA pLKO.1 560 CDS 100% 4.950 3.465 N Fggy n/a
4 TRCN0000025004 CCACTGTTCAAGCCATTGCTT pLKO.1 801 CDS 100% 3.000 2.100 N Fggy n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320432.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15093 pDONR223 0% 69.3% 71.2% None (many diffs) n/a
2 ccsbBroad304_15093 pLX_304 0% 69.3% 71.2% V5 (many diffs) n/a
3 TRCN0000465658 TCACGGTGTCGTACACAATTGAAG pLX_317 21% 69.3% 71.2% V5 (many diffs) n/a
4 ccsbBroadEn_14196 pDONR223 100% 69.2% 71% None (many diffs) n/a
5 ccsbBroad304_14196 pLX_304 0% 69.2% 71% V5 (many diffs) n/a
6 TRCN0000471237 CGTTGCCTAACAATATCCCTCCAC pLX_317 35.6% 69.2% 71% V5 (many diffs) n/a
7 ccsbBroadEn_12196 pDONR223 100% 65.7% 67.9% None (many diffs) n/a
8 ccsbBroad304_12196 pLX_304 0% 65.7% 67.9% V5 (many diffs) n/a
9 TRCN0000467964 CGCCCCGGGGGCGATGGCGACCGA pLX_317 55.6% 65.7% 67.9% V5 (many diffs) n/a
10 TRCN0000489287 TTCGACCCTCTTCGTTCTTGTCGG pLX_317 43.5% 65.7% 67.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV