Transcript: Human XM_024446583.1

PREDICTED: Homo sapiens large tumor suppressor kinase 1 (LATS1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LATS1 (9113)
Length:
7741
CDS:
674..4165

Additional Resources:

NCBI RefSeq record:
XM_024446583.1
NBCI Gene record:
LATS1 (9113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196268 GAATGGGTAGTTCGTCTATAT pLKO.1 2960 CDS 100% 13.200 18.480 N LATS1 n/a
2 TRCN0000199713 GCGAAGGGAATCTCGTATTCA pLKO.1 2548 CDS 100% 5.625 7.875 N LATS1 n/a
3 TRCN0000196748 GATTACAACTTCACCTATTAC pLKO.1 2500 CDS 100% 13.200 9.240 N LATS1 n/a
4 TRCN0000195739 CACACGATTCTAAGTACTATC pLKO.1 3240 CDS 100% 10.800 7.560 N LATS1 n/a
5 TRCN0000001777 CACGGCAAGATAGCATGGATT pLKO.1 3276 CDS 100% 4.950 3.465 N LATS1 n/a
6 TRCN0000001778 GTCTGCTTCATACATTCCTAA pLKO.1 3838 CDS 100% 4.950 3.465 N LATS1 n/a
7 TRCN0000001779 CAAGTCAGAAATCCACCCAAA pLKO.1 863 CDS 100% 4.050 2.835 N LATS1 n/a
8 TRCN0000001780 GAGAAATTAAGCCATCGTGTT pLKO.1 4636 3UTR 100% 4.050 2.835 N LATS1 n/a
9 TRCN0000001776 GAAGATAAAGACACTAGGAAT pLKO.1 2791 CDS 100% 4.950 2.970 N LATS1 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 111 5UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 112 5UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6666 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6666 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488803 CAAGTTGGGTTCATTTCCAAGGGG pLX_317 8% 97.1% 97.1% V5 (not translated due to prior stop codon) 1446T>C;2884_2982del;3141C>T n/a
2 ccsbBroadEn_11336 pDONR223 100% 58.6% 58.2% None (many diffs) n/a
3 ccsbBroad304_11336 pLX_304 0% 58.6% 58.2% V5 (many diffs) n/a
4 TRCN0000470200 GCACGCCCAACACTTTTACGTCTA pLX_317 18.8% 58.6% 58.2% V5 (many diffs) n/a
5 ccsbBroadEn_14930 pDONR223 0% 58.6% 58.2% None (many diffs) n/a
6 ccsbBroad304_14930 pLX_304 0% 58.6% 58.2% V5 (many diffs) n/a
7 TRCN0000472788 ACCGTGTACAGCAGCTCTCGGTAC pLX_317 23% 58.6% 58.2% V5 (many diffs) n/a
8 ccsbBroadEn_11335 pDONR223 100% 11% 10.1% None (many diffs) n/a
9 ccsbBroad304_11335 pLX_304 0% 11% 10.1% V5 (many diffs) n/a
10 TRCN0000466560 AATTGTCACGAACTTAATCGTTTC pLX_317 86.3% 11% 10.1% V5 (many diffs) n/a
Download CSV