Transcript: Human XM_024446787.1

PREDICTED: Homo sapiens protein kinase AMP-activated non-catalytic subunit gamma 2 (PRKAG2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKAG2 (51422)
Length:
6406
CDS:
1052..2188

Additional Resources:

NCBI RefSeq record:
XM_024446787.1
NBCI Gene record:
PRKAG2 (51422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430131 ATCCACAGATTGCCCGTTATT pLKO_005 1472 CDS 100% 13.200 18.480 N PRKAG2 n/a
2 TRCN0000003145 CCTATGGTACAGATTTATGAA pLKO.1 1328 CDS 100% 5.625 4.500 N PRKAG2 n/a
3 TRCN0000433732 AGATAGTATTGTGGGTATTAT pLKO_005 1942 CDS 100% 15.000 10.500 N PRKAG2 n/a
4 TRCN0000434898 AGACTCAGAAAGTGGTGTTTA pLKO_005 1090 CDS 100% 13.200 9.240 N PRKAG2 n/a
5 TRCN0000430309 ATGAGGTCACACAAGTGTTAT pLKO_005 1121 CDS 100% 13.200 9.240 N PRKAG2 n/a
6 TRCN0000429506 ATTTGTGGAAAGACGAATATC pLKO_005 1681 CDS 100% 13.200 9.240 N PRKAG2 n/a
7 TRCN0000195266 CTTCACCACATCCATGAATAA pLKO.1 5974 3UTR 100% 13.200 9.240 N PRKAG2 n/a
8 TRCN0000436467 TTTGTAGGAATGCTAACAATT pLKO_005 1268 CDS 100% 13.200 9.240 N PRKAG2 n/a
9 TRCN0000003148 GAAGTGCAATAAGCTGGAAAT pLKO.1 1855 CDS 100% 10.800 7.560 N PRKAG2 n/a
10 TRCN0000003146 TGGCTGCAAGTGGTTAAGAAT pLKO.1 5403 3UTR 100% 5.625 3.938 N PRKAG2 n/a
11 TRCN0000003149 TCCTATAAGCACGAGCCTGAA pLKO.1 863 5UTR 100% 4.050 2.835 N PRKAG2 n/a
12 TRCN0000003147 GCCTTCATACATCCAGACACT pLKO.1 1637 CDS 100% 2.640 1.584 N PRKAG2 n/a
13 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4827 3UTR 100% 4.950 2.475 Y n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4900 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4900 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03303 pDONR223 100% 85.1% 83.9% None (many diffs) n/a
2 ccsbBroad304_03303 pLX_304 0% 85.1% 83.9% V5 (many diffs) n/a
3 TRCN0000473870 TCGCCAAGCTGGTAATCACGGCAG pLX_317 44.3% 85.1% 83.9% V5 (many diffs) n/a
4 ccsbBroadEn_08289 pDONR223 100% 56% 55.3% None (many diffs) n/a
5 ccsbBroad304_08289 pLX_304 0% 56% 55.3% V5 (many diffs) n/a
6 TRCN0000470612 ACTCCGAGAATTGCACTTTTTGAA pLX_317 25.2% 56% 55.3% V5 (many diffs) n/a
7 ccsbBroadEn_15066 pDONR223 0% 56% 55.3% None (many diffs) n/a
8 ccsbBroad304_15066 pLX_304 0% 56% 55.3% V5 (many diffs) n/a
9 TRCN0000470682 AAGCATTACAACATGTAGGTAAAT pLX_317 27.2% 56% 55.3% V5 (many diffs) n/a
10 TRCN0000488555 GGCGAATAATCCAGTCCTGCTCTC pLX_317 20.9% 52.1% 51.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV