Transcript: Human XM_024448317.1

PREDICTED: Homo sapiens ENAH actin regulator (ENAH), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENAH (55740)
Length:
13454
CDS:
94..2514

Additional Resources:

NCBI RefSeq record:
XM_024448317.1
NBCI Gene record:
ENAH (55740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370690 GCATGCCTTAGAAGTGTTAAA pLKO_005 369 CDS 100% 13.200 18.480 N ENAH n/a
2 TRCN0000091679 CATGCCTTAGAAGTGTTAAAT pLKO.1 370 CDS 100% 15.000 10.500 N Enah n/a
3 TRCN0000312161 CATGCCTTAGAAGTGTTAAAT pLKO_005 370 CDS 100% 15.000 10.500 N Enah n/a
4 TRCN0000370691 AGAGCTGCTGTGATGGTTTAT pLKO_005 82 5UTR 100% 13.200 9.240 N ENAH n/a
5 TRCN0000091680 CAGAAGACAATCGCCCTTTAA pLKO.1 1886 CDS 100% 13.200 9.240 N Enah n/a
6 TRCN0000312162 CAGAAGACAATCGCCCTTTAA pLKO_005 1886 CDS 100% 13.200 9.240 N Enah n/a
7 TRCN0000303614 TCAAGATAAAGTCGCACATTT pLKO_005 2835 3UTR 100% 13.200 9.240 N ENAH n/a
8 TRCN0000310720 TGGGAGAGAGAGCGCAGAATA pLKO_005 826 CDS 100% 13.200 9.240 N ENAH n/a
9 TRCN0000303479 ACAGATACAGGCCGTGGAAAT pLKO_005 2020 CDS 100% 10.800 7.560 N ENAH n/a
10 TRCN0000303551 AGGTGTATGGTCTCAACTTTG pLKO_005 308 CDS 100% 10.800 7.560 N ENAH n/a
11 TRCN0000061823 CCCTACATTTATGAGCTGTAA pLKO.1 2594 3UTR 100% 4.950 3.465 N ENAH n/a
12 TRCN0000061827 GCAGGAACTGAGCAAGTCAAA pLKO.1 2484 CDS 100% 4.950 3.465 N ENAH n/a
13 TRCN0000315703 GCAGGAACTGAGCAAGTCAAA pLKO_005 2484 CDS 100% 4.950 3.465 N ENAH n/a
14 TRCN0000061825 GTCGTGATAAACTGTGCCATT pLKO.1 226 CDS 100% 4.050 2.835 N ENAH n/a
15 TRCN0000061826 CCATCCCAAGAAGAATTGGAA pLKO.1 457 CDS 100% 3.000 2.100 N ENAH n/a
16 TRCN0000061824 CCTCTGTTGAGACTCCTCTAA pLKO.1 1550 CDS 100% 4.950 2.970 N ENAH n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8866 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 10577 3UTR 100% 1.080 0.540 Y GPR83 n/a
19 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 10577 3UTR 100% 1.080 0.540 Y MYORG n/a
20 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 8934 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
21 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8867 3UTR 100% 13.200 6.600 Y LIAS n/a
22 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 9823 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12265 pDONR223 100% 17.1% 15.5% None (many diffs) n/a
2 ccsbBroad304_12265 pLX_304 0% 17.1% 15.5% V5 (many diffs) n/a
3 TRCN0000473140 TGGTTCCTGTATTGCCCGGGGAAG pLX_317 100% 17.1% 15.5% V5 (many diffs) n/a
Download CSV