Transcript: Human XM_024449516.1

PREDICTED: Homo sapiens sterile alpha motif domain containing 4A (SAMD4A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD4A (23034)
Length:
6872
CDS:
306..2504

Additional Resources:

NCBI RefSeq record:
XM_024449516.1
NBCI Gene record:
SAMD4A (23034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308062 TCGACGCGAAAGTAGAATATA pLKO_005 589 CDS 100% 15.000 21.000 N SAMD4A n/a
2 TRCN0000184529 GCAGAAGCTCTTTCGGTCTTT pLKO.1 1952 CDS 100% 4.950 3.960 N Samd4 n/a
3 TRCN0000116143 CCCACCACAATCAATACGATT pLKO.1 981 CDS 100% 4.950 3.465 N SAMD4A n/a
4 TRCN0000116144 GCTCATAGACAAGTGTCTAAT pLKO.1 1874 CDS 100% 1.320 0.924 N SAMD4A n/a
5 TRCN0000308059 AGCCTCCGCCTGCACAAATAT pLKO_005 1305 CDS 100% 15.000 9.000 N SAMD4A n/a
6 TRCN0000116146 GCAACAGGAATCCAAGGATAA pLKO.1 518 CDS 100% 10.800 6.480 N SAMD4A n/a
7 TRCN0000288937 GCAACAGGAATCCAAGGATAA pLKO_005 518 CDS 100% 10.800 6.480 N SAMD4A n/a
8 TRCN0000296041 ACATCCAGCCACTTCGTTAAA pLKO_005 698 CDS 100% 13.200 18.480 N SAMD4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07831 pDONR223 100% 85.8% 85.7% None (many diffs) n/a
2 ccsbBroad304_07831 pLX_304 0% 85.8% 85.7% V5 (many diffs) n/a
3 TRCN0000491644 TAACATCATGGATAGATATGTGGT pLX_317 18.5% 85.8% 85.7% V5 (many diffs) n/a
4 ccsbBroadEn_15747 pDONR223 0% 42.8% 42.8% None 1_1227del;2083_2084ins66 n/a
5 ccsbBroad304_15747 pLX_304 0% 42.8% 42.8% V5 1_1227del;2083_2084ins66 n/a
6 TRCN0000465896 TGGTACACAGTCATTTGCATACCT pLX_317 39.4% 42.8% 42.8% V5 1_1227del;2083_2084ins66 n/a
7 ccsbBroadEn_11662 pDONR223 100% 33.2% 32.6% None (many diffs) n/a
8 ccsbBroad304_11662 pLX_304 0% 33.2% 32.6% V5 (many diffs) n/a
9 TRCN0000469313 GCGTCCTGTCCTACTGCTGGTGAC pLX_317 65% 33.2% 32.6% V5 (many diffs) n/a
Download CSV