Transcript: Human XM_024449988.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 5 (MAP2K5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K5 (5607)
Length:
2769
CDS:
1290..2405

Additional Resources:

NCBI RefSeq record:
XM_024449988.1
NBCI Gene record:
MAP2K5 (5607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001467 GCCCTCCAATATGCTAGTAAA pLKO.1 1913 CDS 100% 13.200 18.480 N MAP2K5 n/a
2 TRCN0000197077 GCTGGTAATTCGCATCAAGAT pLKO.1 699 5UTR 100% 4.950 6.930 N MAP2K5 n/a
3 TRCN0000320675 GCTGGTAATTCGCATCAAGAT pLKO_005 699 5UTR 100% 4.950 6.930 N MAP2K5 n/a
4 TRCN0000199430 CCGTCGCCCTTCTCCGTATGC pLKO.1 2460 3UTR 100% 0.000 0.000 N MAP2K5 n/a
5 TRCN0000320678 CCGTCGCCCTTCTCCGTATGC pLKO_005 2460 3UTR 100% 0.000 0.000 N MAP2K5 n/a
6 TRCN0000196513 GCTGTAAAGGTCATACTACTA pLKO.1 1635 CDS 100% 4.950 3.960 N MAP2K5 n/a
7 TRCN0000199610 GCATTGTTGATGAGGATTCGC pLKO.1 2179 CDS 100% 2.640 2.112 N MAP2K5 n/a
8 TRCN0000320677 GCATTGTTGATGAGGATTCGC pLKO_005 2179 CDS 100% 2.640 2.112 N MAP2K5 n/a
9 TRCN0000320679 ATGAAGATGGTGATCGAATTA pLKO_005 1249 5UTR 100% 13.200 9.240 N MAP2K5 n/a
10 TRCN0000199800 GAGAACCAGGTGCTGGTAATT pLKO.1 688 5UTR 100% 13.200 9.240 N MAP2K5 n/a
11 TRCN0000380735 GTTGTTAAAGGCCTTACTTAT pLKO_005 1857 CDS 100% 13.200 9.240 N MAP2K5 n/a
12 TRCN0000001468 CCGTTCATCGTGCAGTTCAAT pLKO.1 2307 CDS 100% 5.625 3.938 N MAP2K5 n/a
13 TRCN0000001469 CCAATATGCTAGTAAACACAA pLKO.1 1918 CDS 100% 4.950 3.465 N MAP2K5 n/a
14 TRCN0000025236 CGTGCAGTTCAATGATGGAAA pLKO.1 2315 CDS 100% 4.950 3.465 N Map2k5 n/a
15 TRCN0000322119 CGTGCAGTTCAATGATGGAAA pLKO_005 2315 CDS 100% 4.950 3.465 N Map2k5 n/a
16 TRCN0000001466 AGGACCAGTAACCAAGGAGAA pLKO.1 2431 3UTR 100% 4.050 2.835 N MAP2K5 n/a
17 TRCN0000001470 CTGATGTCTGGAGCTTAGGAA pLKO.1 2068 CDS 100% 3.000 2.100 N MAP2K5 n/a
18 TRCN0000320676 CTGATGTCTGGAGCTTAGGAA pLKO_005 2068 CDS 100% 3.000 2.100 N MAP2K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01290 pDONR223 100% 82.8% 82.8% None 0_1ins231 n/a
2 ccsbBroad304_01290 pLX_304 0% 82.8% 82.8% V5 0_1ins231 n/a
3 ccsbBroadEn_14809 pDONR223 0% 82.8% 82.8% None 0_1ins231 n/a
4 ccsbBroad304_14809 pLX_304 0% 82.8% 82.8% V5 0_1ins231 n/a
5 TRCN0000465680 AGGTGACCTATTCTTTCAGAAATC pLX_317 20.8% 82.8% 82.8% V5 0_1ins231 n/a
6 TRCN0000488580 TGTTTACCTTTCTAAGTGAGACGG pLX_317 20.9% 82.8% 82.8% V5 (not translated due to prior stop codon) 0_1ins231 n/a
Download CSV