Transcript: Human XM_024450830.1

PREDICTED: Homo sapiens protein kinase C alpha (PRKCA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCA (5578)
Length:
8617
CDS:
151..1911

Additional Resources:

NCBI RefSeq record:
XM_024450830.1
NBCI Gene record:
PRKCA (5578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001693 CCCGTCTTAACACCACCTGAT pLKO.1 1795 CDS 100% 4.050 5.670 N PRKCA n/a
2 TRCN0000001691 CGAGCTATTTCAGTCTATCAT pLKO.1 1524 CDS 100% 5.625 4.500 N PRKCA n/a
3 TRCN0000233515 ACAAGGAGTGTTGCGAAATTT pLKO_005 6558 3UTR 100% 15.000 10.500 N PRKCA n/a
4 TRCN0000233511 ACCATCCGCTCCACACTAAAT pLKO_005 532 CDS 100% 13.200 9.240 N PRKCA n/a
5 TRCN0000001692 CATGGAACTCAGGCAGAAATT pLKO.1 786 CDS 100% 13.200 9.240 N PRKCA n/a
6 TRCN0000195250 CTGAATATACTGGGCTATTTG pLKO.1 7320 3UTR 100% 13.200 9.240 N PRKCA n/a
7 TRCN0000233514 GAAGATGAAGACGAGCTATTT pLKO_005 1513 CDS 100% 13.200 9.240 N PRKCA n/a
8 TRCN0000196730 GACACAATTGTGCTCTATTTG pLKO.1 3251 3UTR 100% 13.200 9.240 N PRKCA n/a
9 TRCN0000196909 GCTGTACTTCGTCATGGAATA pLKO.1 1128 CDS 100% 10.800 7.560 N PRKCA n/a
10 TRCN0000001690 CTTTGGAGTTTCGGAGCTGAT pLKO.1 672 CDS 100% 4.050 2.835 N PRKCA n/a
11 TRCN0000233513 CTGTGGGACTCCAGATTATAT pLKO_005 1386 CDS 100% 15.000 9.000 N PRKCA n/a
12 TRCN0000233512 GGGACCTCATGTACCACATTC pLKO_005 1160 CDS 100% 10.800 6.480 N PRKCA n/a
13 TRCN0000022874 CCTTATGTGAAGCTGAAACTA pLKO.1 472 CDS 100% 5.625 3.938 N Prkca n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6840 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6840 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01281 pDONR223 100% 86.4% 85.8% None (many diffs) n/a
2 TRCN0000472511 CAAAGCGAGGGGGAGCATCGCTTC pLX_317 22.4% 86.4% 85.8% V5 (many diffs) n/a
3 ccsbBroad304_01281 pLX_304 33.6% 86.3% 53.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489154 CGCAACGTCAAACTGACCTGCCAT pLX_317 20.3% 86.4% 85.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14788 pDONR223 72.5% 85.9% 19% None (many diffs) n/a
6 ccsbBroad304_14788 pLX_304 26.3% 85.9% 19% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000475052 TTCAATCGGTGGGAGACCACTGAG pLX_317 18.9% 85.9% 19% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV