Transcript: Human XM_024451246.1

PREDICTED: Homo sapiens YES proto-oncogene 1, Src family tyrosine kinase (YES1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YES1 (7525)
Length:
4618
CDS:
155..1786

Additional Resources:

NCBI RefSeq record:
XM_024451246.1
NBCI Gene record:
YES1 (7525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148961 AAATTGGTGAAACACTACAC pXPR_003 AGG 719 44% 6 1.2433 YES1 YES1 77967
2 BRDN0001145317 AGAGAGAGTGAAACAACTAA pXPR_003 AGG 569 35% 5 0.3427 YES1 YES1 77965
3 BRDN0001487120 TCCAAAAGGCGTTACCCCTG pXPR_003 AGG 199 12% 2 -0.1248 YES1 YES1 77966
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195217 CAGGTGGTGTTACTATATTTG pLKO.1 423 CDS 100% 13.200 18.480 N YES1 n/a
2 TRCN0000197092 GACTACTTCACTGCTACAGAG pLKO.1 1736 CDS 100% 4.050 5.670 N YES1 n/a
3 TRCN0000121230 GCAGATTCCATTCAGGCAGAA pLKO.1 602 CDS 100% 4.050 5.670 N YES1 n/a
4 TRCN0000121063 GCTGGTTTAACAGGTGGTGTT pLKO.1 413 CDS 100% 4.050 5.670 N YES1 n/a
5 TRCN0000010015 CAATTATGTAGCGCCTGCAGA pLKO.1 586 CDS 100% 2.640 3.696 N YES1 n/a
6 TRCN0000121231 CCTCGAGAATCTTTGCGACTA pLKO.1 971 CDS 100% 0.000 0.000 N YES1 n/a
7 TRCN0000121246 GCAAACAGAACTAGTAACAAA pLKO.1 1537 CDS 100% 0.000 0.000 N YES1 n/a
8 TRCN0000001609 CTGCACTGTATGGTCGGTTTA pLKO.1 1482 CDS 100% 10.800 8.640 N YES1 n/a
9 TRCN0000121243 GCTGATGGTATGGCATATATT pLKO.1 1295 CDS 100% 15.000 10.500 N YES1 n/a
10 TRCN0000121245 ACTACAGAAGACCTTTCATTT pLKO.1 470 CDS 100% 13.200 9.240 N YES1 n/a
11 TRCN0000196418 GCTCCTCACTTAGCTATATTC pLKO.1 2902 3UTR 100% 13.200 9.240 N YES1 n/a
12 TRCN0000121062 GCTGTCATTATTTCCTCTTAT pLKO.1 3963 3UTR 100% 13.200 9.240 N YES1 n/a
13 TRCN0000010006 TGGTTATATCCCGAGCAATTA pLKO.1 571 CDS 100% 13.200 9.240 N YES1 n/a
14 TRCN0000121065 CCTGGAAATCAACGAGGTATT pLKO.1 677 CDS 100% 10.800 7.560 N YES1 n/a
15 TRCN0000121227 GCAAAGTAAGACCCAGCATTT pLKO.1 2617 3UTR 100% 10.800 7.560 N YES1 n/a
16 TRCN0000121244 TCCCTCCATGAATTGATGAAT pLKO.1 1652 CDS 100% 5.625 3.938 N YES1 n/a
17 TRCN0000121242 CCAAAGTCAGAATTGCTCAAA pLKO.1 2106 3UTR 100% 4.950 3.465 N YES1 n/a
18 TRCN0000121064 GCAAGGTTAATTGAAGACAAT pLKO.1 1406 CDS 100% 4.950 3.465 N YES1 n/a
19 TRCN0000001608 GCAGTTAATTTCAGCAGTCTT pLKO.1 305 CDS 100% 4.950 3.465 N YES1 n/a
20 TRCN0000121229 TGATGGTTTATGCCACAAGTT pLKO.1 886 CDS 100% 4.950 3.465 N YES1 n/a
21 TRCN0000010004 GCTGCACTGTATGGTCGGTTT pLKO.1 1481 CDS 100% 4.050 2.835 N YES1 n/a
22 TRCN0000001610 GTTACTATATTTGTGGCCTTA pLKO.1 431 CDS 100% 4.050 2.835 N YES1 n/a
23 TRCN0000121066 CTGCTCAGATTGCTGATGGTA pLKO.1 1284 CDS 100% 3.000 2.100 N YES1 n/a
24 TRCN0000121228 CAAGTTCATATCCTGCTGGTT pLKO.1 399 CDS 100% 2.640 1.848 N YES1 n/a
25 TRCN0000010019 ACTATATCACAACCAGAGCAC pLKO.1 819 CDS 100% 2.160 1.512 N YES1 n/a
26 TRCN0000194696 CAGAACATGCTGATGGTTTAT pLKO.1 876 CDS 100% 13.200 7.920 N YES1 n/a
27 TRCN0000001611 ACCACGAAAGTAGCAATCAAA pLKO.1 1049 CDS 100% 5.625 3.375 N YES1 n/a
28 TRCN0000001607 CCAGCCTACATTCACTTCTAA pLKO.1 3394 3UTR 100% 5.625 3.375 N YES1 n/a
29 TRCN0000023615 CCAGGTACAATGATGCCAGAA pLKO.1 1079 CDS 100% 4.050 2.430 N Yes1 n/a
30 TRCN0000339083 CCAGGTACAATGATGCCAGAA pLKO_005 1079 CDS 100% 4.050 2.430 N Yes1 n/a
31 TRCN0000361213 TTGACAATGGTGGATACTATA pLKO_005 804 CDS 100% 13.200 6.600 Y Fyn n/a
32 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3357 3UTR 100% 5.625 2.813 Y KLHL30 n/a
33 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3357 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01787 pDONR223 100% 99.9% 100% None 1444T>C n/a
2 ccsbBroad304_01787 pLX_304 4.9% 99.9% 100% V5 1444T>C n/a
3 TRCN0000468660 CCTCACAGCATATCTTCAATGCAC pLX_317 26.1% 99.9% 100% V5 1444T>C n/a
4 ccsbBroadEn_14878 pDONR223 0% 99.9% 100% None 1444T>C n/a
5 ccsbBroad304_14878 pLX_304 37.4% 99.9% 100% V5 1444T>C n/a
6 TRCN0000471113 TACTGTGATCAAACCCTAGACCTT pLX_317 24.4% 99.9% 100% V5 1444T>C n/a
Download CSV