Transcript: Human XM_024451688.1

PREDICTED: Homo sapiens zinc finger protein 28 (ZNF28), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF28 (7576)
Length:
4497
CDS:
220..2217

Additional Resources:

NCBI RefSeq record:
XM_024451688.1
NBCI Gene record:
ZNF28 (7576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421076 AGATCTTTGGTCACAATACAT pLKO_005 893 CDS 100% 5.625 3.938 N ZNF28 n/a
2 TRCN0000425574 CATCGTAGATCTCACATTGAT pLKO_005 841 CDS 100% 5.625 3.938 N ZNF28 n/a
3 TRCN0000159780 GTCACAAATCACAGCTTGAAA pLKO.1 2834 3UTR 100% 5.625 3.938 N ZNF28 n/a
4 TRCN0000444783 GCGCTTCATACTGCAGACAAA pLKO_005 931 CDS 100% 4.950 3.465 N ZNF28 n/a
5 TRCN0000433076 CAACACCTTCCATCACAATTC pLKO_005 2319 3UTR 100% 10.800 6.480 N ZNF28 n/a
6 TRCN0000158874 GTAATGAATGTGGCATAGTTT pLKO.1 2726 3UTR 100% 5.625 3.375 N ZNF28 n/a
7 TRCN0000158444 CAAATGTGAAGACTGTGACAA pLKO.1 2805 3UTR 100% 4.950 2.970 N ZNF28 n/a
8 TRCN0000159031 GACAAAGTTGTCAGTCACAAA pLKO.1 2821 3UTR 100% 4.950 2.970 N ZNF28 n/a
9 TRCN0000158709 GCAAGTCATCATAGTCTTCAT pLKO.1 2767 3UTR 100% 4.950 2.970 N ZNF28 n/a
10 TRCN0000147524 GAGAGTGGCAAATCCTTTAAT pLKO.1 715 CDS 100% 15.000 7.500 Y ZNF321P n/a
11 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1357 CDS 100% 6.000 3.000 Y Zfp612 n/a
12 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1193 CDS 100% 5.625 2.813 Y ZNF345 n/a
13 TRCN0000147302 GTCGCAAATCACATCTTGAAA pLKO.1 1238 CDS 100% 5.625 2.813 Y ZNF321P n/a
14 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 962 CDS 100% 5.625 2.813 Y ZNF702P n/a
15 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 2626 3UTR 100% 4.950 2.475 Y ZNF28 n/a
16 TRCN0000143454 GCAAAGCGTTTACTTCACATT pLKO.1 3320 3UTR 100% 4.950 2.475 Y ZNF468 n/a
17 TRCN0000141972 GCACAACATCAGAGAGTTCAT pLKO.1 1843 CDS 100% 4.950 2.475 Y ZNF468 n/a
18 TRCN0000140423 GCACGCCATCATAGACTTCAT pLKO.1 1423 CDS 100% 4.950 2.475 Y ZNF468 n/a
19 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1130 CDS 100% 4.950 2.475 Y ZNF813 n/a
20 TRCN0000141128 CCTCAGTTTCAACATCCCAAA pLKO.1 575 CDS 100% 4.050 2.025 Y ZNF468 n/a
21 TRCN0000162177 CAAATGTGATGAGTGTGGCAA pLKO.1 2637 3UTR 100% 2.640 1.320 Y ZNF28 n/a
22 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1298 CDS 100% 2.640 1.320 Y ZNF468 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08581 pDONR223 100% 49.9% 43.7% None (many diffs) n/a
2 ccsbBroad304_08581 pLX_304 0% 49.9% 43.7% V5 (many diffs) n/a
3 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 49.9% 43.7% V5 (many diffs) n/a
4 ccsbBroadEn_05629 pDONR223 100% 22.1% 18.4% None (many diffs) n/a
5 ccsbBroad304_05629 pLX_304 0% 22.1% 18.4% V5 (many diffs) n/a
6 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 22.1% 18.4% V5 (many diffs) n/a
Download CSV