Transcript: Human XR_001737285.1

PREDICTED: Homo sapiens FGGY carbohydrate kinase domain containing (FGGY), transcript variant X32, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGGY (55277)
Length:
1790
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737285.1
NBCI Gene record:
FGGY (55277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230922 TCGAGCAGTCAGTCAAGTTAA pLKO_005 487 3UTR 100% 13.200 18.480 N FGGY n/a
2 TRCN0000230924 GGATCAGCAAAGACCCGATTT pLKO_005 1038 3UTR 100% 10.800 15.120 N FGGY n/a
3 TRCN0000218124 AGTTGTACAAGGGATTGATTT pLKO_005 340 3UTR 100% 13.200 9.240 N FGGY n/a
4 TRCN0000078670 GAAGACTTTGTTGCAGATAAT pLKO.1 773 3UTR 100% 13.200 9.240 N FGGY n/a
5 TRCN0000230925 TGAACACCAGAAGGAGTATTT pLKO_005 1602 3UTR 100% 13.200 9.240 N FGGY n/a
6 TRCN0000230923 TGGGATAAGGCGGGACATTTC pLKO_005 620 3UTR 100% 10.800 7.560 N FGGY n/a
7 TRCN0000078668 CCACAGTTCAAGCCATTGCTT pLKO.1 1265 3UTR 100% 3.000 2.100 N FGGY n/a
8 TRCN0000078672 GCTTCACTCATTGATGCCCAT pLKO.1 902 3UTR 100% 2.160 1.512 N FGGY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15093 pDONR223 0% 60.3% None 1_472del;1208_1209ins148;1642_1790del n/a
2 ccsbBroad304_15093 pLX_304 0% 60.3% V5 1_472del;1208_1209ins148;1642_1790del n/a
3 TRCN0000465658 TCACGGTGTCGTACACAATTGAAG pLX_317 21% 60.3% V5 1_472del;1208_1209ins148;1642_1790del n/a
4 ccsbBroadEn_14196 pDONR223 100% 60.2% None (many diffs) n/a
5 ccsbBroad304_14196 pLX_304 0% 60.2% V5 (many diffs) n/a
6 TRCN0000471237 CGTTGCCTAACAATATCCCTCCAC pLX_317 35.6% 60.2% V5 (many diffs) n/a
7 ccsbBroadEn_12196 pDONR223 100% 31.3% None 1_1033del;1208_1209ins148;1642_1790del n/a
8 ccsbBroad304_12196 pLX_304 0% 31.3% V5 1_1033del;1208_1209ins148;1642_1790del n/a
9 TRCN0000467964 CGCCCCGGGGGCGATGGCGACCGA pLX_317 55.6% 31.3% V5 1_1033del;1208_1209ins148;1642_1790del n/a
10 TRCN0000489287 TTCGACCCTCTTCGTTCTTGTCGG pLX_317 43.5% 31.3% V5 (not translated due to prior stop codon) 1_1033del;1208_1209ins148;1642_1790del n/a
Download CSV