Transcript: Human XR_001737532.1

PREDICTED: Homo sapiens angel homolog 2 (ANGEL2), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANGEL2 (90806)
Length:
4811
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737532.1
NBCI Gene record:
ANGEL2 (90806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245072 ATCCAAGGCGAGGTGATATTA pLKO_005 1385 3UTR 100% 15.000 21.000 N ANGEL2 n/a
2 TRCN0000245074 GCCATAACTGTGGATTATATT pLKO_005 1740 3UTR 100% 15.000 21.000 N ANGEL2 n/a
3 TRCN0000245075 GGATATTATGTGCCCTAATTA pLKO_005 4040 3UTR 100% 15.000 21.000 N ANGEL2 n/a
4 TRCN0000108091 CCGCCCTGATATTTCTCTGTT pLKO.1 1266 3UTR 100% 4.950 6.930 N ANGEL2 n/a
5 TRCN0000108092 CGTAGCAAATACGCATCTGTT pLKO.1 1359 3UTR 100% 4.950 6.930 N ANGEL2 n/a
6 TRCN0000108093 GCTGGAACAGACATATTTCTA pLKO.1 330 3UTR 100% 5.625 4.500 N ANGEL2 n/a
7 TRCN0000245073 TTCCTGGTTCTCCACTATATA pLKO_005 1508 3UTR 100% 15.000 10.500 N ANGEL2 n/a
8 TRCN0000108090 GCAGGATATTATGTGCCCTAA pLKO.1 4037 3UTR 100% 4.050 2.835 N ANGEL2 n/a
9 TRCN0000108094 GCCAGTATTACACTGGAGTTT pLKO.1 1020 3UTR 100% 0.495 0.347 N ANGEL2 n/a
10 TRCN0000245071 ATACTTCAGTAGTAGGCATTT pLKO_005 394 3UTR 100% 10.800 6.480 N ANGEL2 n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3758 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12944 pDONR223 100% 15.6% None (many diffs) n/a
2 ccsbBroad304_12944 pLX_304 0% 15.6% V5 (many diffs) n/a
3 ccsbBroadEn_12945 pDONR223 100% 14.8% None 1_951del;1576_1577ins127;1683_4811del n/a
4 ccsbBroad304_12945 pLX_304 0% 14.8% V5 1_951del;1576_1577ins127;1683_4811del n/a
5 TRCN0000465557 AGCCCGCTCACATCTTTTAGGTCA pLX_317 49.3% 14.8% V5 1_951del;1576_1577ins127;1683_4811del n/a
6 ccsbBroadEn_10792 pDONR223 100% 4.4% None (many diffs) n/a
7 ccsbBroad304_10792 pLX_304 0% 4.4% V5 (many diffs) n/a
8 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.4% V5 (many diffs) n/a
9 ccsbBroadEn_11616 pDONR223 100% 3.5% None (many diffs) n/a
10 ccsbBroad304_11616 pLX_304 0% 3.5% V5 (many diffs) n/a
11 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.5% V5 (many diffs) n/a
Download CSV