Construct: ORF TRCN0000465557
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000907.1_s317c1
- Derived from:
- ccsbBroadEn_12945
- DNA Barcode:
- AGCCCGCTCACATCTTTTAGGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANGEL2 (90806)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465557
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90806 | ANGEL2 | angel homolog 2 | NM_001300757.1 | 76.2% | 76.2% | 859_1125del |
| 2 | human | 90806 | ANGEL2 | angel homolog 2 | NM_001300758.1 | 76.2% | 76.2% | 859_1125del |
| 3 | human | 90806 | ANGEL2 | angel homolog 2 | NM_001300753.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 4 | human | 90806 | ANGEL2 | angel homolog 2 | NM_001300755.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 5 | human | 90806 | ANGEL2 | angel homolog 2 | XM_017002775.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 6 | human | 90806 | ANGEL2 | angel homolog 2 | XM_017002776.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 7 | human | 90806 | ANGEL2 | angel homolog 2 | XM_017002777.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 8 | human | 90806 | ANGEL2 | angel homolog 2 | XM_017002778.1 | 68.4% | 68.4% | 1_129del;988_1254del |
| 9 | human | 90806 | ANGEL2 | angel homolog 2 | XM_005273347.3 | 61.5% | 61.5% | 1_270del;1129_1395del |
| 10 | human | 90806 | ANGEL2 | angel homolog 2 | XM_005273344.1 | 54.7% | 54.7% | 1_441del;1300_1566del |
| 11 | human | 90806 | ANGEL2 | angel homolog 2 | XM_005273345.1 | 54.7% | 54.7% | 1_441del;1300_1566del |
| 12 | human | 90806 | ANGEL2 | angel homolog 2 | XM_005273346.2 | 54.7% | 54.7% | 1_441del;1300_1566del |
| 13 | human | 90806 | ANGEL2 | angel homolog 2 | XM_017002774.1 | 54.7% | 54.7% | 1_441del;1300_1566del |
| 14 | human | 90806 | ANGEL2 | angel homolog 2 | NM_144567.5 | 52.5% | 52.5% | 1_507del;1366_1632del |
| 15 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737527.1 | 17.2% | 1_521del;1146_1147ins127;1253_4102del | |
| 16 | human | 90806 | ANGEL2 | angel homolog 2 | XR_247045.3 | 16.8% | 1_631del;1256_1257ins127;1363_4212del | |
| 17 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737528.1 | 16.6% | 1_399del;1024_1025ins127;1131_4259del | |
| 18 | human | 90806 | ANGEL2 | angel homolog 2 | NR_125333.1 | 16.6% | 1_385del;1010_1011ins127;1117_4264del | |
| 19 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737530.1 | 15.7% | 1_660del;1285_1286ins127;1392_4520del | |
| 20 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737529.2 | 15.4% | 1_732del;1357_1358ins127;1464_4592del | |
| 21 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737532.1 | 14.8% | 1_951del;1576_1577ins127;1683_4811del | |
| 22 | human | 90806 | ANGEL2 | angel homolog 2 | XR_001737531.1 | 14.8% | 1_952del;1577_1578ins127;1684_4812del | |
| 23 | mouse | 52477 | Angel2 | angel homolog 2 | XM_006497186.2 | 58.6% | 61.2% | (many diffs) |
| 24 | mouse | 52477 | Angel2 | angel homolog 2 | XM_017321690.1 | 47.8% | 48.5% | (many diffs) |
| 25 | mouse | 52477 | Angel2 | angel homolog 2 | NM_001199020.1 | 46.9% | 49% | (many diffs) |
| 26 | mouse | 52477 | Angel2 | angel homolog 2 | XM_006497183.3 | 46.9% | 49% | (many diffs) |
| 27 | mouse | 52477 | Angel2 | angel homolog 2 | XM_006497184.3 | 46.9% | 49% | (many diffs) |
| 28 | mouse | 52477 | Angel2 | angel homolog 2 | XM_006497185.1 | 46.9% | 49% | (many diffs) |
| 29 | mouse | 52477 | Angel2 | angel homolog 2 | NM_021421.4 | 45% | 47% | (many diffs) |
| 30 | mouse | 52477 | Angel2 | angel homolog 2 | NR_037579.1 | 25.3% | (many diffs) | |
| 31 | mouse | 52477 | Angel2 | angel homolog 2 | NR_037578.1 | 23% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 924
- ORF length:
- 858
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ctataatata ctttcacaag atttactgga agataactct cacctttata 121 gacattgccg gcggccagta ttacactgga gttttaggtt tcccaatatt ctgaaagaaa 181 ttaaacattt tgatgcagac gtactttgtt tgcaagaagt tcaagaagat cattatggag 241 cagagatcag gccaagtttg gaatcactgg gttatcactg tgaatataag atgcggacag 301 gaaggaaacc tgatggctgt gctatttgct tcaaacattc caaattttca ctcttgtcag 361 tgaacccagt ggaattcttc cgccctgata tttctctgtt ggacagagac aatgttggat 421 tagttttact cttacagccc aaaattccat atgctgcctg ccctgcaatc tgcgtagcaa 481 atacgcatct gttgtataat cCAAGGCGAG GTGATATTAA GCTGACGCAA TTGGCAATGC 541 TACTGGCAGA GATTTCCAGT GTTGCCCACC AGAAAGATGG CAGCTTCTGC CCTATTGTTA 601 TGTGTGGTGA CTTTAATTCT GTTCCTGGTT CTCCACTATA TAGTTTCATA AAGGAAGGAA 661 AATTGAATTA TGAAGGACTT CCCATAGGAA AGGTATCTGG CCAGGAACAG TCTTCACGGG 721 GACAAAGAAT TTTATCTATT CCAATTTGGC CCCCAAACCT AGGTATCTCA CAGAACTGTG 781 TGTATGAGGT ACAGCAGGTA CCAAAAGTAG AAAAGACAGA CAGTGATCTG ACACAAACAC 841 AGCTGAAGCA AACAGAGGTC CTAGTGACAG CTGAAAAATT GTCTTCAAAT TTACAGCACC 901 ATTTCAGTTT GTCATCTGTT TATTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 961 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1021 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA GCCCGCTCAC 1081 ATCTTTTAGG TCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1141 att