Transcript: Human XR_001741099.1

PREDICTED: Homo sapiens LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated (LSM6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LSM6 (11157)
Length:
2830
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741099.1
NBCI Gene record:
LSM6 (11157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074721 CGGACGACCAGTTGTGGTAAA pLKO.1 167 3UTR 100% 10.800 15.120 N LSM6 n/a
2 TRCN0000187052 CTGGATGGCTACATGAATATA pLKO.1 228 3UTR 100% 15.000 10.500 N Gm10043 n/a
3 TRCN0000074719 CCGAGGAAACAATGTGTTGTA pLKO.1 314 3UTR 100% 4.950 3.465 N LSM6 n/a
4 TRCN0000074718 GTGATACAATTTGTCCTCTTT pLKO.1 437 3UTR 100% 4.950 3.465 N LSM6 n/a
5 TRCN0000074722 CATGAATATAGCCCTGGAGCA pLKO.1 239 3UTR 100% 2.160 1.512 N LSM6 n/a
6 TRCN0000414709 AGAATATGTAAATGGACAACT pLKO_005 266 3UTR 100% 4.950 2.970 N LSM6 n/a
7 TRCN0000074720 CAGTACACAGAAGAGACGGAT pLKO.1 338 3UTR 100% 2.640 1.584 N LSM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02633 pDONR223 100% 8.4% None 1_119del;360_2830del n/a
2 ccsbBroad304_02633 pLX_304 0% 8.4% V5 1_119del;360_2830del n/a
3 TRCN0000473537 AGCGTGGCTAAGTCTAATTGTTAA pLX_317 100% 8.4% V5 1_119del;360_2830del n/a
Download CSV