Transcript: Human XR_001744687.1

PREDICTED: Homo sapiens zinc finger protein 680 (ZNF680), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF680 (340252)
Length:
3110
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744687.1
NBCI Gene record:
ZNF680 (340252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436833 TAATGGGTGCTCCAGCCTTAC pLKO_005 1544 3UTR 100% 6.000 8.400 N ZNF680 n/a
2 TRCN0000107338 GCCTGCAACTCTTGCTAATCA pLKO.1 1718 3UTR 100% 5.625 7.875 N ZNF680 n/a
3 TRCN0000412700 CAATGATTGTTACACTTGCTT pLKO_005 1965 3UTR 100% 3.000 4.200 N ZNF680 n/a
4 TRCN0000430843 GACAAAGCCTTCCAATGATTG pLKO_005 1953 3UTR 100% 10.800 7.560 N ZNF680 n/a
5 TRCN0000107336 CCTGCAACTCTTGCTAATCAT pLKO.1 1719 3UTR 100% 5.625 3.938 N ZNF680 n/a
6 TRCN0000107339 GAGTCTAAGGTGTTCAAAGAA pLKO.1 690 3UTR 100% 5.625 3.938 N ZNF680 n/a
7 TRCN0000107337 GCCTCACCTGATAACCTGTTT pLKO.1 355 3UTR 100% 4.950 3.465 N ZNF680 n/a
8 TRCN0000431972 CATCCTGTTGAGAAACCCTAA pLKO_005 1917 3UTR 100% 4.050 2.835 N ZNF680 n/a
9 TRCN0000422607 GCAAAGTTCTTAACTGGTTCT pLKO_005 946 3UTR 100% 4.050 2.835 N ZNF680 n/a
10 TRCN0000435876 CATCTAACACAACATATAAGA pLKO_005 885 3UTR 100% 5.625 3.375 N ZNF680 n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1333 3UTR 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1333 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1333 3UTR 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 1804 3UTR 100% 4.950 2.475 Y ZNF681 n/a
15 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 334 3UTR 100% 4.950 2.475 Y ZNF675 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10024 pDONR223 100% 51% None (many diffs) n/a
2 ccsbBroad304_10024 pLX_304 0% 51% V5 (many diffs) n/a
3 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 51% V5 (many diffs) n/a
4 ccsbBroadEn_11550 pDONR223 100% 41.8% None (many diffs) n/a
5 ccsbBroad304_11550 pLX_304 0% 41.8% V5 (many diffs) n/a
6 ccsbBroadEn_11384 pDONR223 100% 7.5% None (many diffs) n/a
7 ccsbBroad304_11384 pLX_304 0% 7.5% V5 (many diffs) n/a
8 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 7.5% V5 (many diffs) n/a
9 ccsbBroadEn_15729 pDONR223 0% 7.1% None (many diffs) n/a
10 ccsbBroad304_15729 pLX_304 0% 7.1% V5 (many diffs) n/a
11 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 7.1% V5 (many diffs) n/a
12 ccsbBroadEn_13746 pDONR223 100% 6.5% None (many diffs) n/a
13 ccsbBroad304_13746 pLX_304 0% 6.5% V5 (many diffs) n/a
14 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 6.5% V5 (many diffs) n/a
Download CSV