Transcript: Human XR_001748865.1

PREDICTED: Homo sapiens zinc finger protein 26 (ZNF26), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF26 (7574)
Length:
5462
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748865.1
NBCI Gene record:
ZNF26 (7574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014863 CGGATAATATAGACAGGATTT pLKO.1 2864 3UTR 100% 10.800 15.120 N ZNF26 n/a
2 TRCN0000229684 TACATCGGAAGACTCATAAAT pLKO_005 2796 3UTR 100% 15.000 12.000 N ZNF26 n/a
3 TRCN0000218352 AGCTCCAAGCAGAAGTTATTT pLKO_005 1633 3UTR 100% 15.000 10.500 N ZNF26 n/a
4 TRCN0000229685 TACACTAGGAACACCTTATAA pLKO_005 3072 3UTR 100% 15.000 10.500 N ZNF26 n/a
5 TRCN0000218562 AGTGCCAAGTCAAACCTTAAT pLKO_005 1850 3UTR 100% 13.200 9.240 N ZNF26 n/a
6 TRCN0000229683 TCAAGACAGAGACTCTATAAC pLKO_005 1583 3UTR 100% 13.200 9.240 N ZNF26 n/a
7 TRCN0000014864 CCTGATAAGTTTCATGGTTAT pLKO.1 1664 3UTR 100% 10.800 7.560 N ZNF26 n/a
8 TRCN0000014867 GAGAGTATTGAAAGAAGCTAT pLKO.1 1514 3UTR 100% 4.950 3.465 N ZNF26 n/a
9 TRCN0000014865 GCTACTGGATTCTACACAGAA pLKO.1 1303 3UTR 100% 4.950 3.465 N ZNF26 n/a
10 TRCN0000014866 GAGAACTCATTCAACTGAGAA pLKO.1 2551 3UTR 100% 4.950 2.970 N ZNF26 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4716 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 1995 3UTR 100% 3.000 1.500 Y ZNF146 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4716 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07155 pDONR223 100% 29.1% None (many diffs) n/a
2 ccsbBroad304_07155 pLX_304 0% 29.1% V5 (many diffs) n/a
3 TRCN0000467465 AACCAGTGTGTGTGTCATCAAACA pLX_317 27.4% 29.1% V5 (many diffs) n/a
4 ccsbBroadEn_11229 pDONR223 100% 10.9% None 1_2218del;2816_5462del n/a
5 ccsbBroad304_11229 pLX_304 0% 10.9% V5 1_2218del;2816_5462del n/a
6 TRCN0000474811 TGAAGACCGTAAGGCGGCAATTTC pLX_317 80.5% 10.9% V5 1_2218del;2816_5462del n/a
7 ccsbBroadEn_11616 pDONR223 100% 3.1% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 3.1% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.1% V5 (many diffs) n/a
Download CSV