Transcript: Mouse XR_001778411.1

PREDICTED: Mus musculus pericentriolar material 1 (Pcm1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcm1 (18536)
Length:
8546
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778411.1
NBCI Gene record:
Pcm1 (18536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366676 ATCCGTGACTATATTACTAAA pLKO_005 976 3UTR 100% 13.200 18.480 N Pcm1 n/a
2 TRCN0000366677 CATTAGACTGTCGATACAATA pLKO_005 2270 3UTR 100% 13.200 18.480 N Pcm1 n/a
3 TRCN0000375565 GAAACTTAAACAGCGGATAAA pLKO_005 645 3UTR 100% 13.200 18.480 N Pcm1 n/a
4 TRCN0000366745 GAGGGTAACTAACGCTATTTC pLKO_005 516 3UTR 100% 13.200 18.480 N Pcm1 n/a
5 TRCN0000118948 GCGGATAAACTTCAGTGATTT pLKO.1 657 3UTR 100% 13.200 18.480 N PCM1 n/a
6 TRCN0000178640 CGCTCAAACTGACAGTCTATT pLKO.1 6301 3UTR 100% 13.200 10.560 N Pcm1 n/a
7 TRCN0000118949 CGGATAAACTTCAGTGATTTA pLKO.1 658 3UTR 100% 13.200 9.240 N PCM1 n/a
8 TRCN0000375620 TTCTAGCTTTGCAGCATAAAG pLKO_005 1367 3UTR 100% 13.200 9.240 N Pcm1 n/a
9 TRCN0000197840 GAGACTCATCTAACTCTCTTA pLKO.1 6478 3UTR 100% 4.950 3.465 N Pcm1 n/a
10 TRCN0000197946 GCAGCTACTTAATACAGACTA pLKO.1 4680 3UTR 100% 4.950 3.465 N Pcm1 n/a
11 TRCN0000176499 CGAAGAACAAAGATTCCACAT pLKO.1 565 3UTR 100% 4.050 2.835 N Pcm1 n/a
12 TRCN0000176886 GCTCTCTTACATAGAAGAGAA pLKO.1 3417 3UTR 100% 0.495 0.347 N Pcm1 n/a
13 TRCN0000375616 ACCCTTCTTCTCCCAATTTAT pLKO_005 3761 3UTR 100% 15.000 9.000 N Pcm1 n/a
14 TRCN0000144578 GAAGATGAGGAAGAAGAAGAA pLKO.1 2326 3UTR 100% 4.950 2.475 Y PTMS n/a
15 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 7679 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11020 pDONR223 100% 16.8% None (many diffs) n/a
2 ccsbBroad304_11020 pLX_304 0% 16.8% V5 (many diffs) n/a
3 TRCN0000467367 ACTCGGGGTTTTGCCCGAAGCCTT pLX_317 19.5% 16.8% V5 (many diffs) n/a
Download CSV