Transcript: Mouse XR_001778433.1

PREDICTED: Mus musculus kelch-like 36 (Klhl36), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl36 (234796)
Length:
1599
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778433.1
NBCI Gene record:
Klhl36 (234796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435522 GCTCAAGGCCGTGGTAGATTT pLKO_005 519 3UTR 100% 13.200 18.480 N Klhl36 n/a
2 TRCN0000434587 GCTTGCCAAGGTTCACCTATG pLKO_005 1483 3UTR 100% 6.000 8.400 N Klhl36 n/a
3 TRCN0000190569 GAGGACAACTATCTCTACCTA pLKO.1 664 3UTR 100% 3.000 4.200 N Klhl36 n/a
4 TRCN0000201256 GATTTCTACCTAGCTTCCATT pLKO.1 1362 3UTR 100% 4.950 3.960 N Klhl36 n/a
5 TRCN0000202167 CCGCCTCCAACCTTCTTTATA pLKO.1 1313 3UTR 100% 15.000 10.500 N Klhl36 n/a
6 TRCN0000201898 CGCAAGAACCTGCTGTGTTAT pLKO.1 1575 3UTR 100% 13.200 9.240 N Klhl36 n/a
7 TRCN0000418288 GATCTGGACCGTGGTGGATTT pLKO_005 612 3UTR 100% 10.800 7.560 N Klhl36 n/a
8 TRCN0000436742 ACGAGAATGGAGCGCTGTCTT pLKO_005 1414 3UTR 100% 4.950 3.465 N Klhl36 n/a
9 TRCN0000189598 CGGCAGCAACATTGACTACAT pLKO.1 567 3UTR 100% 4.950 3.465 N Klhl36 n/a
10 TRCN0000201447 CAGTGAGTCTTCAAAGGTGTA pLKO.1 279 3UTR 100% 4.050 2.835 N Klhl36 n/a
11 TRCN0000202168 CAGGTACAGCACAAATGGGAA pLKO.1 832 3UTR 100% 2.640 1.848 N Klhl36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08959 pDONR223 100% 56.7% None (many diffs) n/a
2 ccsbBroad304_08959 pLX_304 0% 56.7% V5 (many diffs) n/a
3 TRCN0000474246 AGGCGCAAACGACTTAACGGACCG pLX_317 20.7% 56.7% V5 (many diffs) n/a
4 ccsbBroadEn_12617 pDONR223 100% 50.7% None (many diffs) n/a
5 ccsbBroad304_12617 pLX_304 0% 50.7% V5 (many diffs) n/a
6 TRCN0000477616 GGTCTCAATTTCGCTGGCTGCTTA pLX_317 27.1% 50.7% V5 (many diffs) n/a
Download CSV