Transcript: Human XR_002958676.1

PREDICTED: Homo sapiens EWS RNA binding protein 1 (EWSR1), transcript variant X34, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EWSR1 (2130)
Length:
3819
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958676.1
NBCI Gene record:
EWSR1 (2130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000036 GACCGCCTATGCAACTTCTTA pLKO.1 256 3UTR 100% 5.625 4.500 N EWSR1 n/a
2 TRCN0000272741 GACCGCCTATGCAACTTCTTA pLKO_005 256 3UTR 100% 5.625 4.500 N EWSR1 n/a
3 TRCN0000000037 CAAGTCAATATAGCCAACAGA pLKO.1 819 3UTR 100% 3.000 2.400 N EWSR1 n/a
4 TRCN0000000034 TGCATTGACTACCAGATTTAT pLKO.1 3479 3UTR 100% 15.000 10.500 N EWSR1 n/a
5 TRCN0000272805 TGCATTGACTACCAGATTTAT pLKO_005 3479 3UTR 100% 15.000 10.500 N EWSR1 n/a
6 TRCN0000272742 ATGATCTGGCAGACTTCTTTA pLKO_005 1153 3UTR 100% 13.200 9.240 N EWSR1 n/a
7 TRCN0000375872 ATGATCTGGCAGACTTCTTTA pLKO_005 1153 3UTR 100% 13.200 9.240 N Ewsr1 n/a
8 TRCN0000329671 CCCAGTAGCATGGGTGTTTAT pLKO_005 881 3UTR 100% 13.200 9.240 N EWSR1 n/a
9 TRCN0000375799 CCCAGTAGCATGGGTGTTTAT pLKO_005 881 3UTR 100% 13.200 9.240 N Ewsr1 n/a
10 TRCN0000272806 GACAGCCTCCCACTGGTTATA pLKO_005 279 3UTR 100% 13.200 9.240 N EWSR1 n/a
11 TRCN0000366874 GACAGCCTCCCACTGGTTATA pLKO_005 279 3UTR 100% 13.200 9.240 N Ewsr1 n/a
12 TRCN0000342411 TACGGGCAGCAGAGTTCATTC pLKO_005 848 3UTR 100% 10.800 7.560 N EWSR1 n/a
13 TRCN0000000035 CAACAAAGCTATGGAACCTAT pLKO.1 179 3UTR 100% 4.950 3.465 N EWSR1 n/a
14 TRCN0000320852 TAAATGGTAGTGTGCGGAGTT pLKO_005 3625 3UTR 100% 4.050 2.835 N EWSR1 n/a
15 TRCN0000000038 GCAACAAAGCTATGGAACCTA pLKO.1 178 3UTR 100% 3.000 2.100 N EWSR1 n/a
16 TRCN0000102387 GCTCCAAGTCAATATAGCCAA pLKO.1 815 3UTR 100% 2.640 1.848 N Ewsr1 n/a
17 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1733 3UTR 100% 4.950 2.475 Y CFLAR n/a
18 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1733 3UTR 100% 4.950 2.475 Y C19orf31 n/a
19 TRCN0000091477 AGGAGGATTGTTTGAACCAAA pLKO.1 2418 3UTR 100% 4.950 2.970 N Myrip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15413 pDONR223 0% 50% None (many diffs) n/a
2 ccsbBroad304_15413 pLX_304 0% 50% V5 (many diffs) n/a
3 ccsbBroadEn_15412 pDONR223 0% 50% None (many diffs) n/a
4 ccsbBroad304_15412 pLX_304 0% 50% V5 (many diffs) n/a
5 TRCN0000480501 CGAAGCACATCCAGTGACGGAGTC pLX_317 21.9% 50% V5 (many diffs) n/a
6 ccsbBroadEn_06183 pDONR223 100% 27.2% None (many diffs) n/a
7 ccsbBroad304_06183 pLX_304 0% 27.2% V5 (many diffs) n/a
8 TRCN0000466288 AAGTCCGCGGCTTAGCAAAGCCGG pLX_317 39.5% 27.2% V5 (many diffs) n/a
Download CSV