Transcript: Mouse XR_373542.1

PREDICTED: Mus musculus adaptor-related protein complex AP-1, sigma 3 (Ap1s3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap1s3 (252903)
Length:
1490
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_373542.1
NBCI Gene record:
Ap1s3 (252903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_373542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113118 AGGAGCTGAAACTTGTTTATA pLKO.1 326 3UTR 100% 15.000 10.500 N Ap1s3 n/a
2 TRCN0000113119 GTGAGCTGGATATTATCTTTA pLKO.1 464 3UTR 100% 13.200 9.240 N Ap1s3 n/a
3 TRCN0000416210 CTAGAGATTGTTCATCGTTAT pLKO_005 409 3UTR 100% 10.800 7.560 N Ap1s3 n/a
4 TRCN0000415732 GAAGATCACCCGCGACATCAT pLKO_005 255 3UTR 100% 4.950 3.465 N Ap1s3 n/a
5 TRCN0000438441 CCATGCTGTGAACCTACAAAC pLKO_005 857 3UTR 100% 10.800 6.480 N Ap1s3 n/a
6 TRCN0000113117 GCTGGATAAATACTTTGGAAA pLKO.1 438 3UTR 100% 4.950 2.970 N Ap1s3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_373542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13154 pDONR223 100% 28% None (many diffs) n/a
2 ccsbBroad304_13154 pLX_304 0% 28% V5 (many diffs) n/a
3 TRCN0000471180 ACCCTAGACTGGACCGGGACCCCC pLX_317 80.4% 28% V5 (many diffs) n/a
4 ccsbBroadEn_16090 pDONR223 0% 18.3% None (many diffs) n/a
5 ccsbBroad304_16090 pLX_304 0% 18.3% V5 (many diffs) n/a
6 TRCN0000474332 AACAACTTCACCACCTTTAGTTCA pLX_317 100% 17.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV