Transcript: Mouse XR_377419.3

PREDICTED: Mus musculus Eph receptor B6 (Ephb6), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ephb6 (13848)
Length:
2971
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377419.3
NBCI Gene record:
Ephb6 (13848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377419.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023645 CCACAGCCTGAGCAAACAAAT pLKO.1 2457 3UTR 100% 13.200 9.240 N Ephb6 n/a
2 TRCN0000321892 CCACAGCCTGAGCAAACAAAT pLKO_005 2457 3UTR 100% 13.200 9.240 N Ephb6 n/a
3 TRCN0000023647 TGGACCAAAGTGGACACAATT pLKO.1 1410 3UTR 100% 13.200 9.240 N Ephb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377419.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14630 pDONR223 0% 40.1% None (many diffs) n/a
2 ccsbBroad304_14630 pLX_304 0% 40.1% V5 (many diffs) n/a
3 TRCN0000481066 ACATACGAGACCCATCCACGAAGA pLX_317 11.6% 40.1% V5 (many diffs) n/a
4 ccsbBroadEn_10805 pDONR223 100% 22.4% None (many diffs) n/a
5 ccsbBroad304_10805 pLX_304 0% 22.4% V5 (many diffs) n/a
6 TRCN0000470948 TATCCTAGATGCTGATGGGATATC pLX_317 18.7% 22.4% V5 (many diffs) n/a
Download CSV