Transcript: Human XR_427107.3

PREDICTED: Homo sapiens solute carrier family 11 member 1 (SLC11A1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC11A1 (6556)
Length:
4527
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_427107.3
NBCI Gene record:
SLC11A1 (6556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_427107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426441 ACCCTTGCCATGGAGGTTAAG pLKO_005 2876 3UTR 100% 10.800 15.120 N SLC11A1 n/a
2 TRCN0000043271 CCTTATAACCATTATGGCCTT pLKO.1 752 3UTR 100% 2.160 1.728 N SLC11A1 n/a
3 TRCN0000434971 GCACGGCCATTGCATTCAATC pLKO_005 613 3UTR 100% 10.800 7.560 N SLC11A1 n/a
4 TRCN0000043268 CCAGGAAACATCGAGTCAGAT pLKO.1 372 3UTR 100% 4.950 3.465 N SLC11A1 n/a
5 TRCN0000043272 CTCCTTGAAGAGGACCAGAAA pLKO.1 2630 3UTR 100% 4.950 3.465 N SLC11A1 n/a
6 TRCN0000043269 CTCCTTTATCATCAACCTCTT pLKO.1 1031 3UTR 100% 4.050 2.835 N SLC11A1 n/a
7 TRCN0000043270 CCCACCCTCATGCAGGAGTTT pLKO.1 2372 3UTR 100% 1.650 1.155 N SLC11A1 n/a
8 TRCN0000422774 TGAAATAGTGTCTGATGAATG pLKO_005 3056 3UTR 100% 10.800 6.480 N SLC11A1 n/a
9 TRCN0000150276 GCCCAGCTAATTTGTGTATTT pLKO.1 3244 3UTR 100% 13.200 6.600 Y SPICE1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1520 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 1361 3UTR 100% 4.950 2.475 Y C16orf89 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1520 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_427107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13957 pDONR223 100% 28.2% None (many diffs) n/a
2 ccsbBroad304_13957 pLX_304 0% 28.2% V5 (many diffs) n/a
3 TRCN0000468356 ACACGCCCTTTGTTTTCATCCGAC pLX_317 22.6% 28.2% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1.3% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1.3% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.3% V5 (many diffs) n/a
Download CSV