Transcript: Human XR_934913.3

PREDICTED: Homo sapiens uncharacterized LOC105376844 (LOC105376844), transcript variant X3, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105376844 (105376844)
Length:
1897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934913.3
NBCI Gene record:
LOC105376844 (105376844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263039 TGGTCAGCTGGACTCCATACT pLKO_005 1310 3UTR 100% 4.950 2.475 Y ARL17B n/a
2 TRCN0000139147 CCCATCTCTTGGACAGATGAT pLKO.1 1530 3UTR 100% 0.495 0.248 Y ARL17A n/a
3 TRCN0000166030 CCTCTGGAAATCAGCTGTGTT pLKO.1 1412 3UTR 100% 4.950 2.475 Y NBR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11975 pDONR223 100% 20.9% None (many diffs) n/a
2 ccsbBroad304_11975 pLX_304 0% 20.9% V5 (many diffs) n/a
3 TRCN0000472181 ATTATGTTATCGCGATTGCCACTT pLX_317 93.6% 20.9% V5 (many diffs) n/a
4 ccsbBroadEn_14147 pDONR223 100% 11.4% None (many diffs) n/a
5 ccsbBroad304_14147 pLX_304 0% 11.4% V5 (many diffs) n/a
6 TRCN0000472660 ACATCAACTGCAGGATTCTATGTG pLX_317 100% 11.4% V5 (many diffs) n/a
7 ccsbBroadEn_11473 pDONR223 100% 9.4% None (many diffs) n/a
8 ccsbBroad304_11473 pLX_304 0% 9.4% V5 (many diffs) n/a
9 TRCN0000479820 CGTGGTACGCCAGCATATGCCAGA pLX_317 100% 9.4% V5 (many diffs) n/a
Download CSV