Transcript: Human XR_001736986.1

PREDICTED: Homo sapiens BRO1 domain and CAAX motif containing (BROX), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BROX (148362)
Length:
3740
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001736986.1
NBCI Gene record:
BROX (148362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001736986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265625 ATTTAGAGTCACGACTCATAG pLKO_005 563 3UTR 100% 10.800 15.120 N BROX n/a
2 TRCN0000265630 GACCTGGACCAACAGTCAAAC pLKO_005 913 3UTR 100% 10.800 15.120 N BROX n/a
3 TRCN0000265642 GAATGCAGCAGATTCATATTT pLKO_005 216 3UTR 100% 15.000 10.500 N BROX n/a
4 TRCN0000265634 AGCCTATACCTTTCGAATTTC pLKO_005 1081 3UTR 100% 13.200 9.240 N BROX n/a
5 TRCN0000134917 CCTTGAACTGTTCACTGATTT pLKO.1 171 3UTR 100% 13.200 9.240 N BROX n/a
6 TRCN0000265647 AGAAGTTCATCGAAGCCTAAA pLKO_005 465 3UTR 100% 10.800 7.560 N BROX n/a
7 TRCN0000265629 CTTCACTTGAAGATGTGTTTC pLKO_005 750 3UTR 100% 10.800 7.560 N BROX n/a
8 TRCN0000265635 TAATGTAGCTTTATGGTATAC pLKO_005 390 3UTR 100% 10.800 7.560 N BROX n/a
9 TRCN0000265628 TTCAAGTGGACTGATACATTG pLKO_005 310 3UTR 100% 10.800 7.560 N BROX n/a
10 TRCN0000133775 CCAAGAAAGCAAGTTACGATA pLKO.1 279 3UTR 100% 4.950 3.465 N BROX n/a
11 TRCN0000134743 GAGACTTTATTGGCTAGTGAT pLKO.1 801 3UTR 100% 4.950 3.465 N BROX n/a
12 TRCN0000134683 GTTATTCAATGTCAGGCTGAA pLKO.1 592 3UTR 100% 4.050 2.835 N BROX n/a
13 TRCN0000134719 GCACTGTGTAAAGAATATGGA pLKO.1 882 3UTR 100% 3.000 2.100 N BROX n/a
14 TRCN0000135942 GTGATAAATGCGGTGAAGCAA pLKO.1 817 3UTR 100% 3.000 2.100 N BROX n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1886 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1886 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001736986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05013 pDONR223 100% 32.4% None 1_42del;711_712insGATCATACTTTATCCA;1260_3740del n/a
2 ccsbBroad304_05013 pLX_304 0% 32.4% V5 1_42del;711_712insGATCATACTTTATCCA;1260_3740del n/a
3 TRCN0000470606 TCCAAAATTTCTCGGTGCAACGGC pLX_317 31.3% 32.4% V5 1_42del;711_712insGATCATACTTTATCCA;1260_3740del n/a
4 ccsbBroadEn_12783 pDONR223 100% 5% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 5% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 5% V5 (many diffs) n/a
Download CSV