Construct: ORF TRCN0000472365
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000533.1_s317c1
- Derived from:
- ccsbBroadEn_03576
- DNA Barcode:
- CATCTACGCACTTAACAACACTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDX19A (55308)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472365
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_018332.5 | 100% | 100% | |
| 2 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_007242.7 | 95% | 96% | (many diffs) |
| 3 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320522.1 | 93.5% | 93.5% | 293_294ins93 |
| 4 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001363938.1 | 92.9% | 91.8% | (many diffs) |
| 5 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001014451.3 | 89% | 89.7% | (many diffs) |
| 6 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257172.2 | 87% | 85.6% | (many diffs) |
| 7 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320525.1 | 80.1% | 79.9% | (many diffs) |
| 8 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001014449.3 | 74.5% | 76.3% | (many diffs) |
| 9 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257173.2 | 74.5% | 76.3% | (many diffs) |
| 10 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257174.2 | 74.5% | 76.3% | (many diffs) |
| 11 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320526.1 | 68.6% | 68.6% | 0_1ins450 |
| 12 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257175.2 | 66.8% | 67.7% | (many diffs) |
| 13 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320527.1 | 59.1% | 57.4% | (many diffs) |
| 14 | human | 55308 | DDX19A | DEAD-box helicase 19A | NR_135296.1 | 40.3% | 1_163del;549_550ins218;1380_2796del | |
| 15 | human | 55308 | DDX19A | DEAD-box helicase 19A | XR_002957830.1 | 36.4% | 1_121del;1304_2289del;2542_3939del | |
| 16 | mouse | 13680 | Ddx19a | DEAD (Asp-Glu-Ala-Asp) box ... | NM_007916.2 | 90.9% | 97.4% | (many diffs) |
| 17 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_172284.5 | 88.3% | 93.3% | (many diffs) |
| 18 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001190800.1 | 85.8% | 89.1% | (many diffs) |
| 19 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001190786.1 | 85.1% | 87.4% | (many diffs) |
| 20 | mouse | 13680 | Ddx19a | DEAD (Asp-Glu-Ala-Asp) box ... | XM_006530650.3 | 72.9% | 78.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1500
- ORF length:
- 1434
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tctgcatggc caccgactcg tgggccctgg cggtggacga gcaggaagcg gctgtcaagt 121 cgatgaccaa tttgcagatc aaggaagaga aagtcaaagc agataccaat ggtattatca 181 aaaccagtac cactgccgag aaaacagatg aagaggagaa agaggacaga gctgcccagt 241 ccttactcaa caagctgatc agaagcaacc ttgttgataa cacaaaccaa gtggaagtcc 301 tgcaacggga tccaaactcc cctctgtact cggtgaagtc gtttgaagag cttcggctga 361 aaccacagct tctccaggga gtctatgcca tgggcttcaa tcgaccctcc aagatacaag 421 agaacgcatt acccatgatg cttgctgaac ccccacagaa tctgattgcc cagtctcagt 481 ctggcactgg taaaacagct gcctttgtct tagccatgct cagccgagtg gagccatcag 541 acagataccc ccagtgtctg tgcctctccc caacatatga gctggcgctt caaacaggaa 601 aagtgattga gcagatgggc aaattttacc cagaactgaa gcttgcctat gccgttcgag 661 gcaataaatt ggaaagaggc cagaagatca gtgagcagat tgtcattggc acccctggga 721 ccgtgctgga ctggtgctcc aagctcaagt tcattgatcc caagaaaatc aaggtgtttg 781 ttctggatga ggctgatgtc atgatagcca ctcagggcca ccaagatcag agcatccgca 841 tccagaggat gctgcccagg aactgccaga tgctgctttt ctccgccacc tttgaagact 901 ctgtgtggaa gtttgcccag aaagtggtcc cagacccaaa tgttatcaaa ctgaagcgtg 961 aggaagagac cctggatacc atcaagcagt actatgtcct gtgcagcagc agagacgaga 1021 agttccaggc cttgtgtaac ctctacgggg ccatcaccat tgctcaagcc atgatcTTCT 1081 GCCATACTCG CAAAACAGCT AGTTGGCTGG CAGCAGAGCT CTCAAAAGAA GGCCACCAGG 1141 TGGCTCTGCT GAGTGGGGAG ATGATGGTGG AGCAGAGGGC TGCGGTGATT GAGCGCTTCC 1201 GAGAGGGCAA AGAGAAGGTT TTGGTGACCA CCAACGTGTG TGCCCGCGGC ATTGATGTTG 1261 AACAAGTGTC TGTCGTCATC AACTTTGATC TTCCCGTGGA CAAGGACGGG AATCCTGACA 1321 ATGAGACCTA CCTGCACCGG ATCGGGCGCA CGGGCCGCTT TGGCAAGAGG GGCCTGGCAG 1381 TGAACATGGT GGACAGCAAG CACAGCATGA ACATCCTGAA CAGAATCCAG GAGCATTTTA 1441 ATAAGAAGAT AGAAAGATTG GACACAGATG ATTTGGACGA GATTGAGAAA ATAGCCAACT 1501 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1561 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1621 TTTATATATC TTGTGGAAAG GACGACATCT ACGCACTTAA CAACACTCTA CGCGTTAAGT 1681 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt