Transcript: Human NM_007242.7

Homo sapiens DEAD-box helicase 19B (DDX19B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
DDX19B (11269)
Length:
3275
CDS:
113..1552

Additional Resources:

NCBI RefSeq record:
NM_007242.7
NBCI Gene record:
DDX19B (11269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007242.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365018 GTTGAGCAACTTGCATCTTAA pLKO_005 169 CDS 100% 13.200 18.480 N DDX19B n/a
2 TRCN0000365061 GTGCTGTTGTCAAGACCAATG pLKO_005 219 CDS 100% 6.000 8.400 N DDX19B n/a
3 TRCN0000369971 CATGGGTTTCAATCGTCCATC pLKO_005 439 CDS 100% 4.050 5.670 N DDX19B n/a
4 TRCN0000051128 GCCATGCTTAGCCAAGTAGAA pLKO.1 563 CDS 100% 4.950 3.960 N DDX19B n/a
5 TRCN0000377419 ACGCATTGCCACTGATGCTTG pLKO_005 474 CDS 100% 4.050 3.240 N DDX19B n/a
6 TRCN0000051129 CCTGAACTGAAGCTAGCTTAT pLKO.1 680 CDS 100% 10.800 7.560 N DDX19B n/a
7 TRCN0000365062 CTGAACTGAAGCTAGCTTATG pLKO_005 681 CDS 100% 10.800 7.560 N DDX19B n/a
8 TRCN0000051131 CGTTGAGCAACTTGCATCTTA pLKO.1 168 CDS 100% 5.625 3.938 N DDX19B n/a
9 TRCN0000369997 AGATACCAATGGTGCTGTTGT pLKO_005 208 CDS 100% 4.950 3.465 N DDX19B n/a
10 TRCN0000051132 GCAGAGAAGACAGATGAAGAA pLKO.1 245 CDS 100% 4.950 3.465 N DDX19B n/a
11 TRCN0000377369 TATGAGCTCGCCCTCCAAACA pLKO_005 626 CDS 100% 4.950 3.465 N DDX19B n/a
12 TRCN0000051130 CACAGAACTTAATTGCCCAAT pLKO.1 504 CDS 100% 4.050 2.835 N DDX19B n/a
13 TRCN0000365063 AGCCAAGTAGAACCTGCAAAC pLKO_005 572 CDS 100% 6.000 3.600 N DDX19B n/a
14 TRCN0000365060 CACAGGAGACAAGTGCGTTCA pLKO_005 1596 3UTR 100% 4.050 2.430 N DDX19B n/a
15 TRCN0000050220 CGCGGCATTGATGTTGAACAA pLKO.1 1295 CDS 100% 4.950 2.475 Y DDX19A n/a
16 TRCN0000151004 GATTTGGACGAGATTGAGAAA pLKO.1 1520 CDS 100% 4.950 2.475 Y DDX19A n/a
17 TRCN0000155545 CCAGAAGATCAGTGAGCAGAT pLKO.1 730 CDS 100% 4.050 2.025 Y DDX19A n/a
18 TRCN0000155912 CCAGATACCAATGGTGCTGTT pLKO.1 206 CDS 100% 4.050 2.025 Y DDX19A n/a
19 TRCN0000155474 GCACAGCATGAACATCCTGAA pLKO.1 1450 CDS 100% 4.050 2.025 Y DDX19A n/a
20 TRCN0000152824 GAATCCTGACAATGAGACCTA pLKO.1 1360 CDS 100% 2.640 1.320 Y DDX19A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007242.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02663 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02663 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472192 ATGCACTATTTATGCCGATATGCA pLX_317 32.3% 100% 100% V5 n/a
4 ccsbBroadEn_03576 pDONR223 100% 95% 96% None (many diffs) n/a
5 ccsbBroad304_03576 pLX_304 0% 95% 96% V5 (many diffs) n/a
6 TRCN0000472365 CATCTACGCACTTAACAACACTCT pLX_317 29.8% 95% 96% V5 (many diffs) n/a
7 ccsbBroadEn_02664 pDONR223 100% 77.2% 77.2% None 1_327del n/a
8 ccsbBroad304_02664 pLX_304 0% 77.2% 77.2% V5 1_327del n/a
9 TRCN0000492319 TCACCATTCCTGCGTCCACGACGC pLX_317 2.8% 77.2% 77.2% V5 1_327del n/a
Download CSV